Incidental Mutation 'R1894:Sorcs3'
ID211846
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Namesortilin-related VPS10 domain containing receptor 3
Synonyms6330404A12Rik
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location48206025-48805505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48794274 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1076 (Q1076L)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
Predicted Effect probably benign
Transcript: ENSMUST00000078880
AA Change: Q1076L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: Q1076L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48683658 critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48748319 missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48603864 missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48767103 missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48796375 missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48790131 missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48794168 missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48535531 missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48654072 missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48704370 splice site probably benign
IGL02830:Sorcs3 APN 19 48723002 splice site probably null
IGL02943:Sorcs3 APN 19 48759938 missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48603894 missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48654044 missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48748319 missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48797517 critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48802698 nonsense probably null
R0646:Sorcs3 UTSW 19 48206295 missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48487406 missense probably benign
R0792:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48693994 missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48487394 missense probably benign
R1253:Sorcs3 UTSW 19 48206736 missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48694001 critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48764181 missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48748359 critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48603875 missense possibly damaging 0.87
R2426:Sorcs3 UTSW 19 48722925 missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48398711 missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48603904 missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48722956 missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48749373 missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48693914 missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48683597 missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48794163 missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48764148 missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48759951 missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48759845 critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48796472 splice site probably null
R5848:Sorcs3 UTSW 19 48788511 missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48749396 missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48796450 missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48398697 missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48759857 missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48790166 missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48802759 missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48764307 critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48788505 missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48713571 missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48693824 missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48749343 missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48705963 missense probably damaging 1.00
R7379:Sorcs3 UTSW 19 48772266 missense possibly damaging 0.69
R7953:Sorcs3 UTSW 19 48764295 missense possibly damaging 0.84
R8043:Sorcs3 UTSW 19 48764295 missense possibly damaging 0.84
R8242:Sorcs3 UTSW 19 48206474 missense possibly damaging 0.53
R8343:Sorcs3 UTSW 19 48704369 splice site probably null
R8433:Sorcs3 UTSW 19 48206474 missense possibly damaging 0.53
R8435:Sorcs3 UTSW 19 48206474 missense possibly damaging 0.53
R8436:Sorcs3 UTSW 19 48206474 missense possibly damaging 0.53
X0018:Sorcs3 UTSW 19 48772289 missense probably damaging 1.00
Z1176:Sorcs3 UTSW 19 48645804 missense probably damaging 1.00
Z1177:Sorcs3 UTSW 19 48704300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCCTGGCTAATAATGTGGATGC -3'
(R):5'- GATGTTGGTGCCAGAGTCAC -3'

Sequencing Primer
(F):5'- ATAATGTGGATGCCTGACCC -3'
(R):5'- AGTCACTGGGTAATTGGTAAGC -3'
Posted On2014-06-30