Incidental Mutation 'R1894:Mecp2'
ID211848
Institutional Source Beutler Lab
Gene Symbol Mecp2
Ensembl Gene ENSMUSG00000031393
Gene Namemethyl CpG binding protein 2
Synonyms1500041B07Rik, D630021H01Rik, WBP10, Mbd5
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R1894 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location74026592-74135363 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74037175 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 79 (A79T)
Ref Sequence ENSEMBL: ENSMUSP00000119947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033770] [ENSMUST00000100750] [ENSMUST00000123362] [ENSMUST00000140399] [ENSMUST00000170481]
Predicted Effect unknown
Transcript: ENSMUST00000033770
AA Change: A79T
SMART Domains Protein: ENSMUSP00000033770
Gene: ENSMUSG00000031393
AA Change: A79T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 40 61 N/A INTRINSIC
low complexity region 82 98 N/A INTRINSIC
MBD 109 186 7.34e-36 SMART
AT_hook 202 214 5.16e0 SMART
low complexity region 248 255 N/A INTRINSIC
AT_hook 282 294 1.2e2 SMART
low complexity region 357 420 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100750
AA Change: A62T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098314
Gene: ENSMUSG00000031393
AA Change: A62T

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
MBD 92 169 7.34e-36 SMART
AT_hook 185 197 5.16e0 SMART
low complexity region 231 238 N/A INTRINSIC
AT_hook 265 277 1.2e2 SMART
low complexity region 340 403 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123362
AA Change: A62T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118842
Gene: ENSMUSG00000031393
AA Change: A62T

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
MBD 92 166 1.19e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140399
AA Change: A79T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119947
Gene: ENSMUSG00000031393
AA Change: A79T

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 40 61 N/A INTRINSIC
low complexity region 82 98 N/A INTRINSIC
MBD 109 183 1.19e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170481
AA Change: A62T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127115
Gene: ENSMUSG00000031393
AA Change: A62T

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
MBD 92 169 7.34e-36 SMART
AT_hook 185 197 5.16e0 SMART
low complexity region 231 238 N/A INTRINSIC
AT_hook 265 277 1.2e2 SMART
low complexity region 340 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of mental retardation in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Female mice homozygous or male mice hemizygous for a null allele exhibit premature death, behavioral and neurological abnormalities, abnormal nervous system phenotypes, abnormal breathing, and abnormal hearing. Heterozygous mice exhibit similar behavioral and neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Mecp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Mecp2 APN X 74035841 missense possibly damaging 0.53
R1387:Mecp2 UTSW X 74035788 missense possibly damaging 0.93
R1888:Mecp2 UTSW X 74037175 missense probably damaging 1.00
R1888:Mecp2 UTSW X 74037175 missense probably damaging 1.00
R1891:Mecp2 UTSW X 74037175 missense probably damaging 1.00
R5890:Mecp2 UTSW X 74035437 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATACTTTCCAGCAGATCGGC -3'
(R):5'- CCTATACTCACTACTGTGCAGAC -3'

Sequencing Primer
(F):5'- AGATCGGCCAGACTTCCTTTG -3'
(R):5'- GCAGACAGCTGTGTTCTCTGTAATAC -3'
Posted On2014-06-30