Incidental Mutation 'R1888:Zfp512b'
ID211860
Institutional Source Beutler Lab
Gene Symbol Zfp512b
Ensembl Gene ENSMUSG00000000823
Gene Namezinc finger protein 512B
SynonymsLOC269401, Znf512b
MMRRC Submission 039909-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1888 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181582103-181592803 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 181588442 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 497 (R497L)
Ref Sequence ENSEMBL: ENSMUSP00000104417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108789] [ENSMUST00000128553] [ENSMUST00000132714] [ENSMUST00000140103] [ENSMUST00000153998]
Predicted Effect probably damaging
Transcript: ENSMUST00000108789
AA Change: R497L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104417
Gene: ENSMUSG00000000823
AA Change: R497L

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
ZnF_C2H2 106 128 5.83e1 SMART
ZnF_C2H2 141 164 3.89e-3 SMART
internal_repeat_1 168 224 4.38e-14 PROSPERO
internal_repeat_1 246 302 4.38e-14 PROSPERO
ZnF_C2H2 487 511 5.68e1 SMART
ZnF_C2H2 517 540 2.91e-2 SMART
low complexity region 547 560 N/A INTRINSIC
ZnF_C2H2 571 593 1.59e1 SMART
ZnF_C2H2 607 630 4.4e-2 SMART
Blast:ZnF_C2H2 727 756 8e-11 BLAST
ZnF_C2H2 761 784 1.45e-2 SMART
low complexity region 808 832 N/A INTRINSIC
low complexity region 838 856 N/A INTRINSIC
low complexity region 858 866 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000128553
AA Change: R507L

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115601
Gene: ENSMUSG00000000823
AA Change: R507L

DomainStartEndE-ValueType
ZnF_C2H2 85 107 5.83e1 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 130 140 N/A INTRINSIC
ZnF_C2H2 151 174 3.89e-3 SMART
internal_repeat_1 178 234 1.6e-14 PROSPERO
internal_repeat_1 256 312 1.6e-14 PROSPERO
ZnF_C2H2 497 521 5.68e1 SMART
ZnF_C2H2 527 550 2.91e-2 SMART
low complexity region 557 570 N/A INTRINSIC
ZnF_C2H2 581 603 1.59e1 SMART
ZnF_C2H2 617 640 4.4e-2 SMART
internal_repeat_2 723 761 4.94e-7 PROSPERO
ZnF_C2H2 771 794 1.45e-2 SMART
low complexity region 818 842 N/A INTRINSIC
low complexity region 848 866 N/A INTRINSIC
low complexity region 868 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131866
Predicted Effect unknown
Transcript: ENSMUST00000132538
AA Change: R55L
SMART Domains Protein: ENSMUSP00000119677
Gene: ENSMUSG00000000823
AA Change: R55L

DomainStartEndE-ValueType
ZnF_C2H2 46 70 5.68e1 SMART
ZnF_C2H2 76 99 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132714
SMART Domains Protein: ENSMUSP00000117711
Gene: ENSMUSG00000002455

DomainStartEndE-ValueType
Pfam:PRP1_N 1 54 6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133598
SMART Domains Protein: ENSMUSP00000114378
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135561
SMART Domains Protein: ENSMUSP00000121721
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136759
Predicted Effect probably benign
Transcript: ENSMUST00000140103
SMART Domains Protein: ENSMUSP00000123579
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
Blast:ZnF_C2H2 2 24 8e-7 BLAST
ZnF_C2H2 29 52 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152365
Predicted Effect probably benign
Transcript: ENSMUST00000153998
SMART Domains Protein: ENSMUSP00000123096
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183624
Meta Mutation Damage Score 0.5914 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,283 K845E possibly damaging Het
4930447C04Rik A G 12: 72,913,256 M80T unknown Het
4930578I06Rik A G 14: 63,986,183 L48P probably damaging Het
Abcc9 A G 6: 142,679,314 S452P probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Adgrf5 T G 17: 43,427,005 probably null Het
Adgrl4 A G 3: 151,439,277 N21S probably benign Het
Adss A T 1: 177,784,951 Y77* probably null Het
Ahnak A T 19: 9,007,088 D1912V probably damaging Het
Ahnak2 A G 12: 112,773,891 M1249T possibly damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Bbs12 C A 3: 37,320,563 L387I probably damaging Het
Cbwd1 A T 19: 24,955,405 V88D probably damaging Het
Ciita T C 16: 10,511,084 Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clec9a G A 6: 129,410,286 V35I probably benign Het
Cntn5 T A 9: 9,984,077 Q382L possibly damaging Het
Dock2 A T 11: 34,707,342 I334N probably damaging Het
Dock9 G T 14: 121,625,205 T833K probably benign Het
Drd2 G A 9: 49,402,142 V204I probably benign Het
Fam120a A T 13: 48,885,866 I938N possibly damaging Het
Fndc1 T C 17: 7,771,789 E1025G unknown Het
Fsip2 G A 2: 82,944,160 D64N probably benign Het
Gm12794 T A 4: 101,941,138 V102E probably damaging Het
Gm14496 T A 2: 182,000,196 C553* probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Hexa A G 9: 59,557,303 T159A probably benign Het
Hmcn1 C G 1: 150,819,500 A218P possibly damaging Het
Hpgds A G 6: 65,138,233 F22S probably damaging Het
Il5ra T A 6: 106,731,913 N289Y probably damaging Het
Irf2 A T 8: 46,807,353 R107* probably null Het
Kcnk6 T C 7: 29,225,650 I180M probably benign Het
Krtap5-3 G A 7: 142,202,242 probably benign Het
Lrig1 C T 6: 94,654,878 A114T probably benign Het
Lrrc37a A G 11: 103,498,761 V1946A probably benign Het
Lrrc8b T C 5: 105,481,351 V521A probably benign Het
Macf1 T G 4: 123,455,042 I2154L possibly damaging Het
Macf1 C A 4: 123,474,712 E2085D probably benign Het
Maml1 C T 11: 50,266,641 A236T probably benign Het
Mdc1 C A 17: 35,854,225 T1481K probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mfap3l T C 8: 60,671,390 V222A possibly damaging Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mpped2 T C 2: 106,699,445 I13T probably benign Het
Mthfd1l C A 10: 4,106,528 T948K probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mtx3 A G 13: 92,847,683 E156G probably benign Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myh2 G A 11: 67,180,850 V498M probably damaging Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Myo1b T A 1: 51,760,403 probably null Het
Ndufa2 T A 18: 36,744,520 probably benign Het
Nipal2 T C 15: 34,625,021 I129M possibly damaging Het
Nt5dc3 A G 10: 86,834,062 N507S possibly damaging Het
Olfr1271 A G 2: 90,265,569 L287P probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pcdhb17 G A 18: 37,487,385 probably null Het
Pcyt2 A G 11: 120,617,851 M1T probably null Het
Pla2g2d T C 4: 138,775,815 M1T probably null Het
Plekhg6 T C 6: 125,363,343 T685A probably damaging Het
Pxk T C 14: 8,151,540 S452P probably damaging Het
Rab42 A T 4: 132,303,218 D40E probably benign Het
Rapgef6 A C 11: 54,660,828 T836P probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Sntb1 T A 15: 55,749,349 R278* probably null Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Stk40 T A 4: 126,125,745 L90Q probably damaging Het
Syk A G 13: 52,640,790 Y520C probably damaging Het
Syngr2 G A 11: 117,813,398 V170M possibly damaging Het
Tcf12 A T 9: 71,858,534 D541E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tlr4 T C 4: 66,841,172 V734A probably damaging Het
Tmem132a T C 19: 10,863,499 E389G probably damaging Het
Tmem150b A G 7: 4,709,045 I112T probably benign Het
Tril A G 6: 53,819,592 L215P probably damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Ttn G A 2: 76,792,807 P15429S probably damaging Het
Ttn T A 2: 76,875,958 probably benign Het
Tubgcp2 A G 7: 139,999,270 V701A probably damaging Het
Tubgcp2 A G 7: 140,006,156 F407L probably damaging Het
Vmn1r30 A C 6: 58,435,490 L119R possibly damaging Het
Washc5 A C 15: 59,359,325 L363R probably damaging Het
Zan T C 5: 137,389,328 T4874A unknown Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Zmat4 A G 8: 24,015,161 N139S probably damaging Het
Other mutations in Zfp512b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp512b APN 2 181587069 missense probably damaging 0.98
IGL00667:Zfp512b APN 2 181589733 missense probably damaging 0.97
IGL00763:Zfp512b APN 2 181590151 missense probably damaging 1.00
IGL01448:Zfp512b APN 2 181587785 missense possibly damaging 0.62
IGL01788:Zfp512b APN 2 181588763 missense possibly damaging 0.86
IGL02048:Zfp512b APN 2 181589922 missense possibly damaging 0.77
IGL02752:Zfp512b APN 2 181588071 missense possibly damaging 0.46
IGL03238:Zfp512b APN 2 181589760 missense probably damaging 1.00
R0421:Zfp512b UTSW 2 181588258 nonsense probably null
R0507:Zfp512b UTSW 2 181584964 unclassified probably benign
R0713:Zfp512b UTSW 2 181588300 missense possibly damaging 0.79
R1074:Zfp512b UTSW 2 181589179 missense probably damaging 0.96
R1513:Zfp512b UTSW 2 181589189 missense probably benign 0.00
R1560:Zfp512b UTSW 2 181588679 missense probably benign 0.00
R1595:Zfp512b UTSW 2 181588436 missense probably damaging 1.00
R1673:Zfp512b UTSW 2 181588493 missense possibly damaging 0.61
R1845:Zfp512b UTSW 2 181585735 missense probably damaging 1.00
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1943:Zfp512b UTSW 2 181588415 missense probably damaging 1.00
R1975:Zfp512b UTSW 2 181587085 nonsense probably null
R2520:Zfp512b UTSW 2 181589502 missense probably damaging 1.00
R3876:Zfp512b UTSW 2 181588763 frame shift probably null
R3877:Zfp512b UTSW 2 181588763 frame shift probably null
R4171:Zfp512b UTSW 2 181590598 unclassified probably null
R4607:Zfp512b UTSW 2 181588774 missense probably damaging 1.00
R4732:Zfp512b UTSW 2 181588739 missense probably benign
R4733:Zfp512b UTSW 2 181588739 missense probably benign
R4766:Zfp512b UTSW 2 181585095 unclassified probably benign
R4888:Zfp512b UTSW 2 181587063 missense probably damaging 1.00
R4965:Zfp512b UTSW 2 181586338 missense probably damaging 1.00
R5632:Zfp512b UTSW 2 181585668 missense probably benign 0.27
R6897:Zfp512b UTSW 2 181590480 missense probably damaging 1.00
R6970:Zfp512b UTSW 2 181586348 missense possibly damaging 0.92
R7432:Zfp512b UTSW 2 181589856 missense probably benign
R7560:Zfp512b UTSW 2 181587082 missense probably damaging 1.00
R8045:Zfp512b UTSW 2 181584824 makesense probably null
R8321:Zfp512b UTSW 2 181587138 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CATACCTTGGCACTGTGTTCAG -3'
(R):5'- GGCTGGATCCTGTAGCAAAG -3'

Sequencing Primer
(F):5'- GCACTGTGTTCAGCCATGG -3'
(R):5'- CTGGATCCTGTAGCAAAGGCATC -3'
Posted On2014-06-30