Incidental Mutation 'R1888:Cntn5'
ID211900
Institutional Source Beutler Lab
Gene Symbol Cntn5
Ensembl Gene ENSMUSG00000039488
Gene Namecontactin 5
SynonymsNB-2, LOC244683, 6720426O10Rik, A830025P08Rik
MMRRC Submission 039909-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1888 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location9660891-10904775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9984077 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 382 (Q382L)
Ref Sequence ENSEMBL: ENSMUSP00000124327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074133
AA Change: Q382L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: Q382L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160216
AA Change: Q382L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: Q382L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGc2 113 179 1.11e-10 SMART
IG 201 289 4.82e-6 SMART
IGc2 312 375 1.4e-16 SMART
IGc2 401 464 8.97e-15 SMART
IGc2 493 557 4.96e-8 SMART
IG 577 667 2.13e-7 SMART
FN3 670 756 1.01e-11 SMART
FN3 773 859 9.19e-1 SMART
FN3 875 958 3.99e-10 SMART
FN3 974 1053 1.68e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162484
AA Change: Q177L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: Q177L

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179049
AA Change: Q177L

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: Q177L

DomainStartEndE-ValueType
IG_like 10 84 1.12e2 SMART
IGc2 107 170 1.4e-16 SMART
IGc2 196 259 8.97e-15 SMART
IGc2 288 352 4.96e-8 SMART
IG 372 462 2.13e-7 SMART
FN3 465 551 1.01e-11 SMART
FN3 568 654 9.19e-1 SMART
FN3 670 753 3.99e-10 SMART
FN3 769 848 1.68e-3 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,283 K845E possibly damaging Het
4930447C04Rik A G 12: 72,913,256 M80T unknown Het
4930578I06Rik A G 14: 63,986,183 L48P probably damaging Het
Abcc9 A G 6: 142,679,314 S452P probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Adgrf5 T G 17: 43,427,005 probably null Het
Adgrl4 A G 3: 151,439,277 N21S probably benign Het
Adss A T 1: 177,784,951 Y77* probably null Het
Ahnak A T 19: 9,007,088 D1912V probably damaging Het
Ahnak2 A G 12: 112,773,891 M1249T possibly damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Bbs12 C A 3: 37,320,563 L387I probably damaging Het
Cbwd1 A T 19: 24,955,405 V88D probably damaging Het
Ciita T C 16: 10,511,084 Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clec9a G A 6: 129,410,286 V35I probably benign Het
Dock2 A T 11: 34,707,342 I334N probably damaging Het
Dock9 G T 14: 121,625,205 T833K probably benign Het
Drd2 G A 9: 49,402,142 V204I probably benign Het
Fam120a A T 13: 48,885,866 I938N possibly damaging Het
Fndc1 T C 17: 7,771,789 E1025G unknown Het
Fsip2 G A 2: 82,944,160 D64N probably benign Het
Gm12794 T A 4: 101,941,138 V102E probably damaging Het
Gm14496 T A 2: 182,000,196 C553* probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Hexa A G 9: 59,557,303 T159A probably benign Het
Hmcn1 C G 1: 150,819,500 A218P possibly damaging Het
Hpgds A G 6: 65,138,233 F22S probably damaging Het
Il5ra T A 6: 106,731,913 N289Y probably damaging Het
Irf2 A T 8: 46,807,353 R107* probably null Het
Kcnk6 T C 7: 29,225,650 I180M probably benign Het
Krtap5-3 G A 7: 142,202,242 probably benign Het
Lrig1 C T 6: 94,654,878 A114T probably benign Het
Lrrc37a A G 11: 103,498,761 V1946A probably benign Het
Lrrc8b T C 5: 105,481,351 V521A probably benign Het
Macf1 T G 4: 123,455,042 I2154L possibly damaging Het
Macf1 C A 4: 123,474,712 E2085D probably benign Het
Maml1 C T 11: 50,266,641 A236T probably benign Het
Mdc1 C A 17: 35,854,225 T1481K probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mfap3l T C 8: 60,671,390 V222A possibly damaging Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mpped2 T C 2: 106,699,445 I13T probably benign Het
Mthfd1l C A 10: 4,106,528 T948K probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mtx3 A G 13: 92,847,683 E156G probably benign Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myh2 G A 11: 67,180,850 V498M probably damaging Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Myo1b T A 1: 51,760,403 probably null Het
Ndufa2 T A 18: 36,744,520 probably benign Het
Nipal2 T C 15: 34,625,021 I129M possibly damaging Het
Nt5dc3 A G 10: 86,834,062 N507S possibly damaging Het
Olfr1271 A G 2: 90,265,569 L287P probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pcdhb17 G A 18: 37,487,385 probably null Het
Pcyt2 A G 11: 120,617,851 M1T probably null Het
Pla2g2d T C 4: 138,775,815 M1T probably null Het
Plekhg6 T C 6: 125,363,343 T685A probably damaging Het
Pxk T C 14: 8,151,540 S452P probably damaging Het
Rab42 A T 4: 132,303,218 D40E probably benign Het
Rapgef6 A C 11: 54,660,828 T836P probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Sntb1 T A 15: 55,749,349 R278* probably null Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Stk40 T A 4: 126,125,745 L90Q probably damaging Het
Syk A G 13: 52,640,790 Y520C probably damaging Het
Syngr2 G A 11: 117,813,398 V170M possibly damaging Het
Tcf12 A T 9: 71,858,534 D541E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tlr4 T C 4: 66,841,172 V734A probably damaging Het
Tmem132a T C 19: 10,863,499 E389G probably damaging Het
Tmem150b A G 7: 4,709,045 I112T probably benign Het
Tril A G 6: 53,819,592 L215P probably damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Ttn G A 2: 76,792,807 P15429S probably damaging Het
Ttn T A 2: 76,875,958 probably benign Het
Tubgcp2 A G 7: 139,999,270 V701A probably damaging Het
Tubgcp2 A G 7: 140,006,156 F407L probably damaging Het
Vmn1r30 A C 6: 58,435,490 L119R possibly damaging Het
Washc5 A C 15: 59,359,325 L363R probably damaging Het
Zan T C 5: 137,389,328 T4874A unknown Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Zfp512b C A 2: 181,588,442 R497L probably damaging Het
Zmat4 A G 8: 24,015,161 N139S probably damaging Het
Other mutations in Cntn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cntn5 APN 9 9976297 missense probably damaging 0.99
IGL01118:Cntn5 APN 9 9831560 missense possibly damaging 0.94
IGL01328:Cntn5 APN 9 9781768 missense probably damaging 1.00
IGL01445:Cntn5 APN 9 9693484 splice site probably benign
IGL01505:Cntn5 APN 9 9706087 missense probably damaging 1.00
IGL01556:Cntn5 APN 9 9673908 missense probably benign
IGL01804:Cntn5 APN 9 9831537 missense probably damaging 0.99
IGL02173:Cntn5 APN 9 9748396 missense probably damaging 1.00
IGL02250:Cntn5 APN 9 10145331 missense probably damaging 1.00
IGL02366:Cntn5 APN 9 9984055 splice site probably benign
IGL02565:Cntn5 APN 9 10145338 nonsense probably null
IGL02593:Cntn5 APN 9 9833499 missense probably damaging 1.00
IGL02743:Cntn5 APN 9 9984110 missense probably damaging 1.00
IGL02976:Cntn5 APN 9 10419099 unclassified probably benign
IGL03103:Cntn5 APN 9 9972812 splice site probably benign
IGL03114:Cntn5 APN 9 9748452 missense probably damaging 1.00
IGL03156:Cntn5 APN 9 9673877 missense probably damaging 1.00
IGL02802:Cntn5 UTSW 9 10048678 splice site probably null
R0243:Cntn5 UTSW 9 9781775 missense probably damaging 1.00
R0385:Cntn5 UTSW 9 9972870 missense probably damaging 1.00
R0541:Cntn5 UTSW 9 9673402 splice site probably benign
R0827:Cntn5 UTSW 9 9666938 missense possibly damaging 0.88
R1029:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1440:Cntn5 UTSW 9 10145339 missense probably damaging 1.00
R1463:Cntn5 UTSW 9 9673796 critical splice donor site probably null
R1536:Cntn5 UTSW 9 9976316 missense possibly damaging 0.78
R1746:Cntn5 UTSW 9 9831572 missense probably damaging 1.00
R1761:Cntn5 UTSW 9 10172054 missense probably benign 0.01
R1764:Cntn5 UTSW 9 9673983 missense probably benign
R1859:Cntn5 UTSW 9 9972834 missense probably damaging 1.00
R1888:Cntn5 UTSW 9 9984077 missense possibly damaging 0.95
R1950:Cntn5 UTSW 9 9781769 missense probably damaging 1.00
R2143:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2145:Cntn5 UTSW 9 9748415 missense probably damaging 0.98
R2437:Cntn5 UTSW 9 10048753 nonsense probably null
R2440:Cntn5 UTSW 9 10171955 missense possibly damaging 0.91
R2504:Cntn5 UTSW 9 10172121 missense probably benign
R3054:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3056:Cntn5 UTSW 9 10419071 missense probably benign 0.30
R3804:Cntn5 UTSW 9 9781663 splice site probably benign
R4164:Cntn5 UTSW 9 9781676 missense probably damaging 1.00
R4444:Cntn5 UTSW 9 9704942 missense probably damaging 1.00
R4472:Cntn5 UTSW 9 10048771 missense probably damaging 1.00
R4576:Cntn5 UTSW 9 9673292 missense probably benign 0.10
R4624:Cntn5 UTSW 9 9704804 nonsense probably null
R4652:Cntn5 UTSW 9 9704912 missense possibly damaging 0.68
R4664:Cntn5 UTSW 9 10144209 missense possibly damaging 0.71
R4679:Cntn5 UTSW 9 9970531 missense probably benign 0.09
R4829:Cntn5 UTSW 9 9976283 missense probably damaging 1.00
R4929:Cntn5 UTSW 9 9976395 critical splice acceptor site probably null
R5211:Cntn5 UTSW 9 9704889 missense possibly damaging 0.88
R5406:Cntn5 UTSW 9 9833460 missense probably damaging 1.00
R5468:Cntn5 UTSW 9 9743628 missense probably damaging 1.00
R5584:Cntn5 UTSW 9 9661452 missense possibly damaging 0.91
R5688:Cntn5 UTSW 9 9748422 missense probably damaging 1.00
R5762:Cntn5 UTSW 9 9748389 missense possibly damaging 0.95
R6141:Cntn5 UTSW 9 10144157 missense probably benign
R6147:Cntn5 UTSW 9 10012889 missense probably damaging 0.98
R6325:Cntn5 UTSW 9 10144323 intron probably null
R6377:Cntn5 UTSW 9 9743652 missense probably damaging 1.00
R6774:Cntn5 UTSW 9 10144217 missense probably damaging 1.00
R7117:Cntn5 UTSW 9 10904699 start gained probably benign
R7252:Cntn5 UTSW 9 9831635 missense probably benign 0.00
R7363:Cntn5 UTSW 9 10172016 missense probably benign 0.00
R7401:Cntn5 UTSW 9 9833461 missense probably benign 0.13
R7488:Cntn5 UTSW 9 9970565 missense probably damaging 0.99
R7548:Cntn5 UTSW 9 9673410 intron probably null
R7662:Cntn5 UTSW 9 9661385 missense probably benign 0.17
R7718:Cntn5 UTSW 9 9984128 missense probably benign
R7719:Cntn5 UTSW 9 9704898 missense probably damaging 1.00
R7788:Cntn5 UTSW 9 9704929 missense probably benign 0.01
R7864:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R7947:Cntn5 UTSW 9 9984177 missense probably damaging 0.98
R8117:Cntn5 UTSW 9 9673950 missense probably benign 0.33
Z1177:Cntn5 UTSW 9 9673962 nonsense probably null
Z1177:Cntn5 UTSW 9 10090236 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTAGTCAACTACAAAGAAGCTG -3'
(R):5'- CCCGGTTCCAACAATTACTTG -3'

Sequencing Primer
(F):5'- CAGATTTCTGAGTTCAAGGCCAGTC -3'
(R):5'- GGATGAAGGTTAACGGTTACATTCC -3'
Posted On2014-06-30