Incidental Mutation 'R1896:Vmn1r158'
ID211982
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Namevomeronasal 1 receptor 158
SynonymsGm16455
MMRRC Submission 039916-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R1896 (G1)
Quality Score196
Status Not validated
Chromosome7
Chromosomal Location22789859-22790782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22790718 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 22 (C22Y)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
Predicted Effect probably damaging
Transcript: ENSMUST00000174643
AA Change: C22Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: C22Y

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik C T 2: 156,865,332 P64S probably damaging Het
1810046K07Rik A G 9: 51,291,798 S19P probably damaging Het
4932438A13Rik C T 3: 36,908,231 Q494* probably null Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
C1qtnf1 G T 11: 118,443,757 G21V probably damaging Het
Car13 T C 3: 14,645,175 I59T probably benign Het
Cep97 T C 16: 55,927,744 N108D probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Endou A G 15: 97,712,992 Y404H probably damaging Het
F12 T C 13: 55,420,727 Y373C probably damaging Het
Fam221b T C 4: 43,660,375 T405A probably damaging Het
Fetub A G 16: 22,932,295 R131G probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Ggt5 T C 10: 75,604,726 V227A probably damaging Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13089 C G 4: 143,698,144 G243A probably benign Het
Gphn A G 12: 78,412,354 D72G possibly damaging Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Jarid2 T C 13: 44,884,882 probably null Het
Kif21b C A 1: 136,147,845 R237S possibly damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lpin3 C T 2: 160,905,298 P815S probably damaging Het
Lrp1 T A 10: 127,559,998 I2468F possibly damaging Het
Nav1 T C 1: 135,460,737 N1118S probably benign Het
Ncoa3 T A 2: 166,048,464 I90N probably benign Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Pkd1l3 C A 8: 109,624,199 P559T possibly damaging Het
Prex1 T A 2: 166,586,654 I716F probably benign Het
Psap C T 10: 60,295,046 Q219* probably null Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Sned1 C T 1: 93,265,047 P352L probably benign Het
Sox4 T C 13: 28,952,144 Y293C probably damaging Het
Srgap3 T A 6: 112,738,997 H654L probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tll2 A G 19: 41,113,059 F379L probably benign Het
Traf3ip3 A G 1: 193,175,734 V492A probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Ush2a T C 1: 188,550,009 V1907A probably benign Het
Uso1 A T 5: 92,201,133 probably null Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve1 A C 12: 83,555,614 V469G probably damaging Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22790779 missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22790445 missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22790647 missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22790430 missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22790390 missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22790214 missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22790754 missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22790374 missense probably benign
R6500:Vmn1r158 UTSW 7 22790653 missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22790691 missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22790040 missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22789881 missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22790676 missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22790224 missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22790300 missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22790008 missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22790062 missense probably damaging 1.00
R8400:Vmn1r158 UTSW 7 22789880 nonsense probably null
Z1177:Vmn1r158 UTSW 7 22790458 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGGAGCAAAAGCCATCATG -3'
(R):5'- TCCCTGCAATTTACCTGTAATGTG -3'

Sequencing Primer
(F):5'- GAGCAAAAGCCATCATGTTGTTTGG -3'
(R):5'- CCACAGAGAGTAGTGTCCTA -3'
Posted On2014-06-30