Incidental Mutation 'R0124:Zfp142'
ID 21200
Institutional Source Beutler Lab
Gene Symbol Zfp142
Ensembl Gene ENSMUSG00000026135
Gene Name zinc finger protein 142
Synonyms 9330177B18Rik
MMRRC Submission 038409-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0124 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 1
Chromosomal Location 74605490-74627308 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74607782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1561 (Y1561H)
Ref Sequence ENSEMBL: ENSMUSP00000109366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027315] [ENSMUST00000027362] [ENSMUST00000066986] [ENSMUST00000067916] [ENSMUST00000113737] [ENSMUST00000113747] [ENSMUST00000113749] [ENSMUST00000141412] [ENSMUST00000113750] [ENSMUST00000152707] [ENSMUST00000127921] [ENSMUST00000156613]
AlphaFold G5E869
Predicted Effect probably damaging
Transcript: ENSMUST00000027315
AA Change: Y1664H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027315
Gene: ENSMUSG00000026135
AA Change: Y1664H

DomainStartEndE-ValueType
ZnF_C2H2 103 127 1.16e1 SMART
ZnF_C2H2 164 186 1.26e-2 SMART
ZnF_C2H2 193 218 7.78e-3 SMART
ZnF_C2H2 223 247 2.29e0 SMART
ZnF_C2H2 250 272 9.96e-1 SMART
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 363 385 9.96e-1 SMART
ZnF_C2H2 391 411 1.26e1 SMART
ZnF_C2H2 419 442 1.47e-3 SMART
ZnF_C2H2 453 475 2.75e-3 SMART
ZnF_C2H2 486 511 3.34e-2 SMART
ZnF_C2H2 516 540 4.81e0 SMART
ZnF_C2H2 543 566 7.05e-1 SMART
ZnF_C2H2 572 595 2.17e-1 SMART
ZnF_C2H2 601 623 1.56e-2 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 657 679 1.38e-3 SMART
ZnF_C2H2 685 707 9.44e-2 SMART
ZnF_C2H2 712 735 1.26e-2 SMART
ZnF_C2H2 744 767 1.31e0 SMART
ZnF_C2H2 773 796 2.63e0 SMART
low complexity region 903 919 N/A INTRINSIC
low complexity region 953 969 N/A INTRINSIC
low complexity region 996 1007 N/A INTRINSIC
ZnF_C2H2 1039 1059 2.01e1 SMART
ZnF_C2H2 1069 1089 1.91e1 SMART
low complexity region 1147 1160 N/A INTRINSIC
ZnF_C2H2 1187 1207 2.7e2 SMART
low complexity region 1209 1222 N/A INTRINSIC
ZnF_C2H2 1265 1285 3.56e1 SMART
ZnF_C2H2 1295 1318 4.98e-1 SMART
ZnF_C2H2 1331 1354 2.49e-1 SMART
ZnF_C2H2 1360 1382 1.03e-2 SMART
ZnF_C2H2 1388 1411 5.72e-1 SMART
ZnF_C2H2 1417 1440 6.75e0 SMART
ZnF_C2H2 1446 1469 9.58e-3 SMART
ZnF_C2H2 1488 1511 1.64e-1 SMART
ZnF_C2H2 1514 1536 1.1e-2 SMART
ZnF_C2H2 1540 1563 4.05e-1 SMART
ZnF_C2H2 1580 1602 4.45e0 SMART
ZnF_C2H2 1608 1630 8.81e-2 SMART
ZnF_C2H2 1636 1658 1.18e-2 SMART
ZnF_C2H2 1664 1686 1.2e-3 SMART
ZnF_C2H2 1692 1715 3.89e-3 SMART
ZnF_C2H2 1721 1743 4.54e-4 SMART
ZnF_C2H2 1749 1771 1.18e-2 SMART
ZnF_C2H2 1777 1799 3.52e-1 SMART
low complexity region 1829 1838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027362
SMART Domains Protein: ENSMUSP00000027362
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066986
AA Change: Y1463H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065149
Gene: ENSMUSG00000026135
AA Change: Y1463H

DomainStartEndE-ValueType
low complexity region 116 128 N/A INTRINSIC
ZnF_C2H2 162 184 9.96e-1 SMART
ZnF_C2H2 190 210 1.26e1 SMART
ZnF_C2H2 218 241 1.47e-3 SMART
ZnF_C2H2 252 274 2.75e-3 SMART
ZnF_C2H2 285 310 3.34e-2 SMART
ZnF_C2H2 315 339 4.81e0 SMART
ZnF_C2H2 342 365 7.05e-1 SMART
ZnF_C2H2 371 394 2.17e-1 SMART
ZnF_C2H2 400 422 1.56e-2 SMART
ZnF_C2H2 428 450 8.94e-3 SMART
ZnF_C2H2 456 478 1.38e-3 SMART
ZnF_C2H2 484 506 9.44e-2 SMART
ZnF_C2H2 511 534 1.26e-2 SMART
ZnF_C2H2 543 566 1.31e0 SMART
ZnF_C2H2 572 595 2.63e0 SMART
low complexity region 702 718 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
ZnF_C2H2 838 858 2.01e1 SMART
ZnF_C2H2 868 888 1.91e1 SMART
low complexity region 946 959 N/A INTRINSIC
ZnF_C2H2 986 1006 2.7e2 SMART
low complexity region 1008 1021 N/A INTRINSIC
ZnF_C2H2 1064 1084 3.56e1 SMART
ZnF_C2H2 1094 1117 4.98e-1 SMART
ZnF_C2H2 1130 1153 2.49e-1 SMART
ZnF_C2H2 1159 1181 1.03e-2 SMART
ZnF_C2H2 1187 1210 5.72e-1 SMART
ZnF_C2H2 1216 1239 6.75e0 SMART
ZnF_C2H2 1245 1268 9.58e-3 SMART
ZnF_C2H2 1287 1310 1.64e-1 SMART
ZnF_C2H2 1313 1335 1.1e-2 SMART
ZnF_C2H2 1339 1362 4.05e-1 SMART
ZnF_C2H2 1379 1401 4.45e0 SMART
ZnF_C2H2 1407 1429 8.81e-2 SMART
ZnF_C2H2 1435 1457 1.18e-2 SMART
ZnF_C2H2 1463 1485 1.2e-3 SMART
ZnF_C2H2 1491 1514 3.89e-3 SMART
ZnF_C2H2 1520 1542 4.54e-4 SMART
ZnF_C2H2 1548 1570 1.18e-2 SMART
ZnF_C2H2 1576 1598 3.52e-1 SMART
low complexity region 1628 1637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067916
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113737
AA Change: Y1561H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109366
Gene: ENSMUSG00000026135
AA Change: Y1561H

DomainStartEndE-ValueType
ZnF_C2H2 93 115 9.81e1 SMART
ZnF_C2H2 120 144 2.29e0 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
low complexity region 214 226 N/A INTRINSIC
ZnF_C2H2 260 282 9.96e-1 SMART
ZnF_C2H2 288 308 1.26e1 SMART
ZnF_C2H2 316 339 1.47e-3 SMART
ZnF_C2H2 350 372 2.75e-3 SMART
ZnF_C2H2 383 408 3.34e-2 SMART
ZnF_C2H2 413 437 4.81e0 SMART
ZnF_C2H2 440 463 7.05e-1 SMART
ZnF_C2H2 469 492 2.17e-1 SMART
ZnF_C2H2 498 520 1.56e-2 SMART
ZnF_C2H2 526 548 8.94e-3 SMART
ZnF_C2H2 554 576 1.38e-3 SMART
ZnF_C2H2 582 604 9.44e-2 SMART
ZnF_C2H2 609 632 1.26e-2 SMART
ZnF_C2H2 641 664 1.31e0 SMART
ZnF_C2H2 670 693 2.63e0 SMART
low complexity region 800 816 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
ZnF_C2H2 936 956 2.01e1 SMART
ZnF_C2H2 966 986 1.91e1 SMART
low complexity region 1044 1057 N/A INTRINSIC
ZnF_C2H2 1084 1104 2.7e2 SMART
low complexity region 1106 1119 N/A INTRINSIC
ZnF_C2H2 1162 1182 3.56e1 SMART
ZnF_C2H2 1192 1215 4.98e-1 SMART
ZnF_C2H2 1228 1251 2.49e-1 SMART
ZnF_C2H2 1257 1279 1.03e-2 SMART
ZnF_C2H2 1285 1308 5.72e-1 SMART
ZnF_C2H2 1314 1337 6.75e0 SMART
ZnF_C2H2 1343 1366 9.58e-3 SMART
ZnF_C2H2 1385 1408 1.64e-1 SMART
ZnF_C2H2 1411 1433 1.1e-2 SMART
ZnF_C2H2 1437 1460 4.05e-1 SMART
ZnF_C2H2 1477 1499 4.45e0 SMART
ZnF_C2H2 1505 1527 8.81e-2 SMART
ZnF_C2H2 1533 1555 1.18e-2 SMART
ZnF_C2H2 1561 1583 1.2e-3 SMART
ZnF_C2H2 1589 1612 3.89e-3 SMART
ZnF_C2H2 1618 1640 4.54e-4 SMART
ZnF_C2H2 1646 1668 1.18e-2 SMART
ZnF_C2H2 1674 1696 3.52e-1 SMART
low complexity region 1726 1735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113747
SMART Domains Protein: ENSMUSP00000109376
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113749
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189956
Predicted Effect probably benign
Transcript: ENSMUST00000141412
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113750
SMART Domains Protein: ENSMUSP00000109379
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 7.16e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152707
SMART Domains Protein: ENSMUSP00000121732
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127921
Predicted Effect probably benign
Transcript: ENSMUST00000156613
Meta Mutation Damage Score 0.6881 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kruppel family of C2H2-type zinc finger proteins. It contains 31 C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,138,656 (GRCm39) T194A probably benign Het
Afap1 C T 5: 36,102,553 (GRCm39) P82S probably damaging Het
Ankrd28 A G 14: 31,449,698 (GRCm39) Y481H probably damaging Het
Arid1b C T 17: 5,389,605 (GRCm39) T1717I probably damaging Het
Atad2b A G 12: 5,002,676 (GRCm39) K348R probably benign Het
Bcl3 C T 7: 19,543,576 (GRCm39) V5M probably damaging Het
C2cd3 A G 7: 100,118,725 (GRCm39) E2321G probably benign Het
Casq1 C T 1: 172,037,992 (GRCm39) V380M probably damaging Het
Cd209e T A 8: 3,901,274 (GRCm39) T127S probably benign Het
Cdh23 G T 10: 60,143,835 (GRCm39) Y2921* probably null Het
Cdh6 A G 15: 13,034,410 (GRCm39) L750P probably damaging Het
Cdk12 T C 11: 98,102,073 (GRCm39) probably benign Het
Ces5a T C 8: 94,255,183 (GRCm39) E170G probably damaging Het
Clec4f A G 6: 83,629,335 (GRCm39) probably null Het
Col19a1 T C 1: 24,565,539 (GRCm39) N264S unknown Het
Col2a1 T A 15: 97,896,743 (GRCm39) I43F unknown Het
Col4a2 A G 8: 11,458,871 (GRCm39) probably benign Het
Csmd3 T A 15: 47,454,112 (GRCm39) D3578V probably damaging Het
Cyp2c37 T C 19: 39,982,546 (GRCm39) L128P probably damaging Het
Dennd2b A G 7: 109,141,718 (GRCm39) S132P possibly damaging Het
Dysf A G 6: 84,042,084 (GRCm39) probably benign Het
Eml1 T C 12: 108,472,867 (GRCm39) V225A probably benign Het
Eml1 A G 12: 108,475,437 (GRCm39) Y256C probably damaging Het
Epb41l5 T A 1: 119,561,370 (GRCm39) K64* probably null Het
Fat2 A G 11: 55,174,504 (GRCm39) F2070L probably damaging Het
Fbxw18 G T 9: 109,520,583 (GRCm39) H259N probably benign Het
Gm10764 A T 10: 87,126,610 (GRCm39) T6S unknown Het
Gm14412 A G 2: 177,007,705 (GRCm39) probably benign Het
Heatr5b A T 17: 79,133,646 (GRCm39) probably benign Het
Hid1 T C 11: 115,247,649 (GRCm39) T250A probably damaging Het
Hnf4g A G 3: 3,708,142 (GRCm39) probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Lrriq1 C T 10: 103,006,281 (GRCm39) probably null Het
Map3k13 A G 16: 21,722,506 (GRCm39) T223A possibly damaging Het
Matn2 C T 15: 34,426,297 (GRCm39) probably benign Het
Myo6 A G 9: 80,215,056 (GRCm39) E1253G probably damaging Het
Nomo1 G T 7: 45,732,652 (GRCm39) probably benign Het
Or1ak2 A T 2: 36,827,268 (GRCm39) I46F possibly damaging Het
Or4c116 A T 2: 88,942,088 (GRCm39) I256K possibly damaging Het
Or8a1b A G 9: 37,622,759 (GRCm39) V272A possibly damaging Het
Papolg C T 11: 23,817,535 (GRCm39) A582T probably benign Het
Plekhm3 C T 1: 64,960,910 (GRCm39) E449K probably damaging Het
Pole T G 5: 110,451,858 (GRCm39) M900R probably damaging Het
Ppp1cb T A 5: 32,640,822 (GRCm39) probably benign Het
Pramel17 A G 4: 101,692,570 (GRCm39) *477Q probably null Het
Pros1 A G 16: 62,734,309 (GRCm39) T372A possibly damaging Het
Scara3 A T 14: 66,168,670 (GRCm39) S316T probably benign Het
Stau2 C T 1: 16,533,352 (GRCm39) A61T probably damaging Het
Stx3 T C 19: 11,769,163 (GRCm39) E54G possibly damaging Het
Sun1 T C 5: 139,232,434 (GRCm39) probably benign Het
Swt1 A T 1: 151,267,280 (GRCm39) C634S probably damaging Het
Syt6 A G 3: 103,494,842 (GRCm39) Y269C probably damaging Het
Tfap2a G A 13: 40,870,887 (GRCm39) probably benign Het
Tmx4 A T 2: 134,481,640 (GRCm39) probably null Het
Ttc39d T C 17: 80,524,375 (GRCm39) C345R probably damaging Het
Vmn1r27 T C 6: 58,192,233 (GRCm39) Y257C probably damaging Het
Vmn2r27 T A 6: 124,208,578 (GRCm39) T56S probably benign Het
Vps13b T C 15: 35,576,674 (GRCm39) probably null Het
Wdr17 A G 8: 55,088,526 (GRCm39) S1175P probably damaging Het
Wsb2 T C 5: 117,501,823 (GRCm39) F63L probably benign Het
Other mutations in Zfp142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Zfp142 APN 1 74,606,131 (GRCm39) missense probably damaging 1.00
IGL00711:Zfp142 APN 1 74,611,593 (GRCm39) missense probably damaging 1.00
IGL01391:Zfp142 APN 1 74,618,699 (GRCm39) missense probably damaging 1.00
IGL01808:Zfp142 APN 1 74,615,184 (GRCm39) missense probably damaging 1.00
IGL02074:Zfp142 APN 1 74,609,022 (GRCm39) missense probably damaging 0.97
IGL02134:Zfp142 APN 1 74,609,022 (GRCm39) missense probably damaging 0.97
IGL02567:Zfp142 APN 1 74,617,309 (GRCm39) missense possibly damaging 0.92
IGL02567:Zfp142 APN 1 74,617,306 (GRCm39) missense possibly damaging 0.84
IGL02567:Zfp142 APN 1 74,617,308 (GRCm39) missense possibly damaging 0.92
IGL02669:Zfp142 APN 1 74,610,432 (GRCm39) missense probably benign 0.18
IGL02694:Zfp142 APN 1 74,609,307 (GRCm39) missense probably damaging 0.98
IGL02884:Zfp142 APN 1 74,611,142 (GRCm39) missense probably damaging 0.99
IGL03000:Zfp142 APN 1 74,612,777 (GRCm39) missense probably benign 0.01
IGL03080:Zfp142 APN 1 74,610,368 (GRCm39) missense probably benign 0.18
IGL03238:Zfp142 APN 1 74,615,437 (GRCm39) missense probably benign 0.37
IGL03277:Zfp142 APN 1 74,610,193 (GRCm39) missense probably damaging 1.00
PIT4402001:Zfp142 UTSW 1 74,618,687 (GRCm39) missense probably damaging 1.00
R0256:Zfp142 UTSW 1 74,617,317 (GRCm39) missense probably benign
R0267:Zfp142 UTSW 1 74,615,223 (GRCm39) missense probably benign 0.05
R0306:Zfp142 UTSW 1 74,609,341 (GRCm39) missense probably damaging 1.00
R0321:Zfp142 UTSW 1 74,608,873 (GRCm39) missense probably damaging 1.00
R0466:Zfp142 UTSW 1 74,624,570 (GRCm39) missense possibly damaging 0.95
R0513:Zfp142 UTSW 1 74,610,714 (GRCm39) missense probably damaging 1.00
R1084:Zfp142 UTSW 1 74,610,985 (GRCm39) missense probably benign
R1534:Zfp142 UTSW 1 74,611,247 (GRCm39) missense probably benign 0.00
R1548:Zfp142 UTSW 1 74,609,263 (GRCm39) missense probably damaging 1.00
R1623:Zfp142 UTSW 1 74,610,934 (GRCm39) missense possibly damaging 0.56
R1628:Zfp142 UTSW 1 74,611,047 (GRCm39) missense possibly damaging 0.94
R1710:Zfp142 UTSW 1 74,611,389 (GRCm39) missense probably damaging 1.00
R1722:Zfp142 UTSW 1 74,608,935 (GRCm39) missense probably damaging 1.00
R1770:Zfp142 UTSW 1 74,618,790 (GRCm39) missense probably damaging 0.99
R2042:Zfp142 UTSW 1 74,609,778 (GRCm39) missense probably benign 0.10
R2112:Zfp142 UTSW 1 74,612,795 (GRCm39) missense probably damaging 1.00
R2249:Zfp142 UTSW 1 74,606,191 (GRCm39) missense probably damaging 1.00
R4393:Zfp142 UTSW 1 74,611,219 (GRCm39) missense probably benign 0.00
R4700:Zfp142 UTSW 1 74,609,431 (GRCm39) missense probably damaging 1.00
R4750:Zfp142 UTSW 1 74,611,617 (GRCm39) missense probably damaging 1.00
R4763:Zfp142 UTSW 1 74,615,671 (GRCm39) missense probably damaging 1.00
R5208:Zfp142 UTSW 1 74,610,027 (GRCm39) missense probably benign 0.18
R5233:Zfp142 UTSW 1 74,624,608 (GRCm39) missense probably damaging 1.00
R5585:Zfp142 UTSW 1 74,617,404 (GRCm39) nonsense probably null
R6192:Zfp142 UTSW 1 74,609,667 (GRCm39) missense probably damaging 1.00
R6461:Zfp142 UTSW 1 74,606,344 (GRCm39) missense probably damaging 1.00
R6482:Zfp142 UTSW 1 74,609,376 (GRCm39) splice site probably null
R7320:Zfp142 UTSW 1 74,609,167 (GRCm39) nonsense probably null
R7438:Zfp142 UTSW 1 74,624,679 (GRCm39) missense probably benign
R7528:Zfp142 UTSW 1 74,610,061 (GRCm39) missense probably benign 0.00
R7600:Zfp142 UTSW 1 74,612,827 (GRCm39) missense probably damaging 1.00
R8007:Zfp142 UTSW 1 74,610,655 (GRCm39) missense probably benign 0.01
R8681:Zfp142 UTSW 1 74,610,747 (GRCm39) missense probably damaging 1.00
R8772:Zfp142 UTSW 1 74,610,825 (GRCm39) missense possibly damaging 0.87
R9058:Zfp142 UTSW 1 74,608,955 (GRCm39) nonsense probably null
R9233:Zfp142 UTSW 1 74,610,288 (GRCm39) missense probably benign
R9281:Zfp142 UTSW 1 74,607,731 (GRCm39) missense probably damaging 1.00
R9302:Zfp142 UTSW 1 74,606,302 (GRCm39) missense probably damaging 0.98
R9454:Zfp142 UTSW 1 74,609,016 (GRCm39) missense probably damaging 1.00
R9569:Zfp142 UTSW 1 74,615,386 (GRCm39) missense probably damaging 1.00
R9595:Zfp142 UTSW 1 74,611,462 (GRCm39) missense probably damaging 1.00
R9680:Zfp142 UTSW 1 74,610,933 (GRCm39) missense probably benign 0.16
Z1177:Zfp142 UTSW 1 74,609,325 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCGCAAATACACTTGCCCAG -3'
(R):5'- CACAGAGATGCTTGCACTATTCCCC -3'

Sequencing Primer
(F):5'- TCAATAGGCTGAGGAGCCATTTC -3'
(R):5'- GCTTGCACTATTCCCCATGTTAAAG -3'
Posted On 2013-04-11