Incidental Mutation 'R0124:Swt1'
ID21201
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene NameSWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location151367699-151428455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151391529 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 634 (C634S)
Ref Sequence ENSEMBL: ENSMUSP00000107514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
Predicted Effect probably damaging
Transcript: ENSMUST00000064771
AA Change: C634S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: C634S

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111883
AA Change: C634S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: C634S

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000141977
AA Change: C143S
Meta Mutation Damage Score 0.7609 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151411139 missense probably damaging 0.99
IGL01622:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01623:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01672:Swt1 APN 1 151394608 critical splice donor site probably null
IGL01693:Swt1 APN 1 151422104 missense probably benign 0.02
IGL02203:Swt1 APN 1 151370626 missense probably benign 0.01
IGL03223:Swt1 APN 1 151379419 missense possibly damaging 0.80
R0496:Swt1 UTSW 1 151411270 missense probably benign
R1037:Swt1 UTSW 1 151370569 splice site probably benign
R1171:Swt1 UTSW 1 151405521 missense probably damaging 1.00
R1270:Swt1 UTSW 1 151384391 missense probably benign 0.00
R1883:Swt1 UTSW 1 151423533 nonsense probably null
R2051:Swt1 UTSW 1 151372330 missense probably damaging 1.00
R2110:Swt1 UTSW 1 151403885 missense probably damaging 0.97
R2185:Swt1 UTSW 1 151384468 missense probably damaging 1.00
R3688:Swt1 UTSW 1 151391489 missense probably damaging 0.99
R3785:Swt1 UTSW 1 151379404 missense probably benign 0.03
R4074:Swt1 UTSW 1 151394769 missense probably benign
R4157:Swt1 UTSW 1 151403044 missense probably damaging 1.00
R4660:Swt1 UTSW 1 151407597 missense probably benign 0.18
R4761:Swt1 UTSW 1 151401102 missense probably benign 0.43
R4972:Swt1 UTSW 1 151423542 missense probably benign 0.22
R5141:Swt1 UTSW 1 151411394 missense probably benign 0.04
R5227:Swt1 UTSW 1 151402976 nonsense probably null
R5400:Swt1 UTSW 1 151412834 missense probably benign 0.00
R5580:Swt1 UTSW 1 151384455 missense probably benign 0.00
R5912:Swt1 UTSW 1 151411409 missense probably damaging 1.00
R5945:Swt1 UTSW 1 151411170 missense probably benign 0.01
R5973:Swt1 UTSW 1 151402949 splice site probably null
R5979:Swt1 UTSW 1 151407588 missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151407614 missense probably benign 0.41
R6283:Swt1 UTSW 1 151384333 missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151397268 missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151370630 missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151388677 missense probably damaging 1.00
R7214:Swt1 UTSW 1 151394613 missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151388693 missense probably benign 0.01
R7439:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7441:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7571:Swt1 UTSW 1 151394719 missense probably benign 0.00
R8028:Swt1 UTSW 1 151384497 missense probably benign 0.26
R8225:Swt1 UTSW 1 151422108 missense possibly damaging 0.96
X0062:Swt1 UTSW 1 151411439 missense probably benign 0.43
Z1176:Swt1 UTSW 1 151388685 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTATTGAAGTCATACCCATGTACAATGGAAG -3'
(R):5'- ACGGAAAGGACCATATAGGAAAGTAGATTGAA -3'

Sequencing Primer
(F):5'- cagcacacgaaggggaag -3'
(R):5'- gaggggaccagggacac -3'
Posted On2013-04-11