Incidental Mutation 'R0124:Casq1'
ID21202
Institutional Source Beutler Lab
Gene Symbol Casq1
Ensembl Gene ENSMUSG00000007122
Gene Namecalsequestrin 1
SynonymsCSQ-1, CSQ1, CSQ, sCSQ
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0124 (G1)
Quality Score222
Status Validated (trace)
Chromosome1
Chromosomal Location172209894-172219868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 172210425 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 380 (V380M)
Ref Sequence ENSEMBL: ENSMUSP00000003554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000013842] [ENSMUST00000111247] [ENSMUST00000155109] [ENSMUST00000170700]
Predicted Effect probably damaging
Transcript: ENSMUST00000003554
AA Change: V380M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: V380M

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 402 5.3e-238 PFAM
Pfam:Thioredoxin_6 186 379 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013842
SMART Domains Protein: ENSMUSP00000013842
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111247
SMART Domains Protein: ENSMUSP00000106878
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 59 9.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152432
Predicted Effect probably benign
Transcript: ENSMUST00000155109
SMART Domains Protein: ENSMUSP00000117735
Gene: ENSMUSG00000013698

DomainStartEndE-ValueType
DED 2 81 2.25e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170638
Predicted Effect probably benign
Transcript: ENSMUST00000170700
SMART Domains Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 94 9.7e-38 PFAM
Pfam:Calsequestrin 89 156 6.9e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171429
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Casq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Casq1 APN 1 172213381 missense probably damaging 0.96
IGL02699:Casq1 APN 1 172219696 start gained probably benign
IGL02756:Casq1 APN 1 172215105 missense probably damaging 1.00
PIT4377001:Casq1 UTSW 1 172212001 missense probably benign 0.15
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0485:Casq1 UTSW 1 172210390 unclassified probably benign
R1982:Casq1 UTSW 1 172215530 missense probably damaging 1.00
R2095:Casq1 UTSW 1 172215962 missense probably benign 0.26
R2097:Casq1 UTSW 1 172210421 missense probably damaging 1.00
R3940:Casq1 UTSW 1 172219536 missense possibly damaging 0.91
R4654:Casq1 UTSW 1 172210398 unclassified probably benign
R4790:Casq1 UTSW 1 172216837 missense probably damaging 1.00
R5002:Casq1 UTSW 1 172213378 missense possibly damaging 0.50
R5187:Casq1 UTSW 1 172213074 missense possibly damaging 0.54
R5307:Casq1 UTSW 1 172219416 missense probably damaging 1.00
R5973:Casq1 UTSW 1 172219501 missense probably damaging 1.00
R6251:Casq1 UTSW 1 172216840 missense probably benign 0.17
R6768:Casq1 UTSW 1 172219678 missense probably benign 0.04
R7380:Casq1 UTSW 1 172216849 missense probably benign 0.07
Z1176:Casq1 UTSW 1 172215914 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGACCACAGTTGGCCCTGTAGTAG -3'
(R):5'- CTCACCACTGAAGGATGCAAGGAAG -3'

Sequencing Primer
(F):5'- TGTAGTAGAGAATGACCTAGTGTCCC -3'
(R):5'- TGCAAGGAAGGGAATGTACAGTAAG -3'
Posted On2013-04-11