Mutagenetix > Incidental Mutation

Incidental Mutation 'R1897:Pik3c2b'

212022

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

039917-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R1897 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 133066916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 206 (D206G)

Ref Sequence

ENSEMBL: ENSMUSP00000115469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000153707]

AlphaFold

E9QAN8

Predicted Effect

probably benign
Transcript: ENSMUST00000077730
AA Change: D206G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447
AA Change: D206G

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124934

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145153

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153707
AA Change: D206G

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115469
Gene: ENSMUSG00000026447
AA Change: D206G

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186515

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	A	G	1: 155,558,818	S61G	probably damaging	Het
Acot12	A	G	13: 91,784,397	N504S	probably benign	Het
Adcy3	C	T	12: 4,173,450		probably benign	Het
Adcyap1r1	A	T	6: 55,479,194	H168L	probably damaging	Het
Adgrd1	A	G	5: 129,129,001	E213G	probably benign	Het
Aldh1l2	G	T	10: 83,502,525	T510K	probably damaging	Het
Apol7e	A	T	15: 77,717,894	M231L	probably benign	Het
Asb1	C	A	1: 91,546,925		probably null	Het
Atf7ip2	C	T	16: 10,211,084	P160L	probably damaging	Het
Atp8a1	A	G	5: 67,738,429	L554P	probably damaging	Het
Ccdc18	A	T	5: 108,196,042	M884L	probably benign	Het
Ccdc93	A	G	1: 121,491,212	I499V	probably benign	Het
Ccl20	A	G	1: 83,117,895	D60G	probably damaging	Het
Cdhr3	T	C	12: 33,045,193	T626A	possibly damaging	Het
Cep250	A	G	2: 155,976,095	E789G	probably damaging	Het
Cmpk2	T	C	12: 26,474,047	L281P	probably damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Crocc	G	A	4: 141,018,736	R1691C	probably damaging	Het
Csf1	C	T	3: 107,748,279	V90M	probably damaging	Het
Cul2	T	G	18: 3,414,164	M86R	probably benign	Het
Dbndd2	T	C	2: 164,488,664	F79S	probably damaging	Het
Dkk1	G	T	19: 30,549,278	N34K	possibly damaging	Het
Dnah6	T	A	6: 73,181,762	L619F	probably benign	Het
Eif2b5	T	C	16: 20,507,037	V588A	probably damaging	Het
Elf3	A	T	1: 135,257,137	Y104N	probably damaging	Het
Fahd2a	T	C	2: 127,436,610	D272G	probably damaging	Het
Fbxw15	A	T	9: 109,558,203	C188*	probably null	Het
Fbxw8	T	C	5: 118,128,876	Y174C	probably benign	Het
Gnl1	C	A	17: 35,988,692	P585Q	possibly damaging	Het
Greb1l	T	C	18: 10,498,992	S292P	probably benign	Het
Gsk3b	G	A	16: 38,217,084		probably null	Het
Hcls1	C	T	16: 36,962,643	P452L	probably damaging	Het
Hdlbp	A	T	1: 93,422,285		probably benign	Het
Hecw1	A	G	13: 14,377,940	S25P	probably damaging	Het
Hells	T	C	19: 38,940,484	V100A	probably benign	Het
Isl1	C	T	13: 116,303,330	E161K	probably benign	Het
Klra9	G	T	6: 130,185,592	N160K	possibly damaging	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Mpc1	G	A	17: 8,296,878	R134Q	possibly damaging	Het
Myo5c	A	T	9: 75,292,241	N1377I	probably benign	Het
Myrf	T	C	19: 10,218,232	I607V	probably benign	Het
Olfr123	T	G	17: 37,796,184	S247A	probably benign	Het
Olfr968	A	T	9: 39,772,065	I245K	probably damaging	Het
Pipox	A	G	11: 77,882,742	Y228H	probably damaging	Het
Pitrm1	T	A	13: 6,560,095	V401D	possibly damaging	Het
Plod1	C	T	4: 147,926,200	E265K	probably damaging	Het
Ptpn21	A	T	12: 98,680,405		probably null	Het
Qars	C	T	9: 108,514,083	Q7*	probably null	Het
Rpap2	T	A	5: 107,633,095	V479E	possibly damaging	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Rusc2	A	G	4: 43,421,749	Y723C	probably damaging	Het
Ryr2	A	T	13: 11,750,932	M1306K	probably benign	Het
Sesn3	A	C	9: 14,308,645	Y110S	probably damaging	Het
Sgce	C	T	6: 4,691,511	V319I	probably benign	Het
Slc15a5	G	T	6: 138,079,764	F51L	possibly damaging	Het
Slit2	T	A	5: 48,238,423	C723S	probably damaging	Het
Sncaip	A	G	18: 52,894,790		probably null	Het
Snx2	T	A	18: 53,197,878	D138E	probably damaging	Het
Spef2	A	T	15: 9,729,654	L126*	probably null	Het
Stam	T	C	2: 14,129,026	S195P	probably damaging	Het
Strn	T	C	17: 78,682,842	I82V	probably benign	Het
Synj2	T	A	17: 6,022,137	C202*	probably null	Het
Tecpr2	A	G	12: 110,933,247	D683G	probably benign	Het
Tfec	A	G	6: 16,835,308	V157A	probably damaging	Het
Tff1	T	G	17: 31,164,938	Q28P	probably benign	Het
Vmn2r86	A	G	10: 130,452,445	Y396H	probably damaging	Het
Vmn2r87	A	T	10: 130,471,960	M803K	probably damaging	Het
Vmn2r90	A	G	17: 17,733,304	K577E	probably damaging	Het
Vrk1	T	C	12: 106,036,540		probably benign	Het
Wdr20	A	G	12: 110,793,723	T348A	probably benign	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GAGATGCTCTTTGTCTCCAGG -3'
(R):5'- AGGTGTCCTTGTTGAAGTCC -3'

Sequencing Primer
(F):5'- TGACACAGATGGCTCTTGC -3'
(R):5'- CCTTGTTGAAGTCCAGGGGC -3'

Posted On

2014-06-30