Mutagenetix > Incidental Mutation

Incidental Mutation 'R1897:Elf3'

212023

Institutional Source

Beutler Lab

Gene Symbol

Elf3

Ensembl Gene

ENSMUSG00000003051

Gene Name

E74-like factor 3

Synonyms

ESX, jen, ESE-1

MMRRC Submission

039917-MU

Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R1897 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135253575-135258568 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 135257137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 104 (Y104N)

Ref Sequence

ENSEMBL: ENSMUSP00000003135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]

AlphaFold

Q3UPW2

PDB Structure

Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000003135
AA Change: Y104N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: Y104N

Domain	Start	End	E-Value	Type
SAM_PNT	67	151	6.32e-30	SMART
low complexity region	230	241	N/A	INTRINSIC
AT_hook	264	276	1.29e0	SMART
ETS	292	379	6.11e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180981

Predicted Effect

probably damaging
Transcript: ENSMUST00000185752
AA Change: Y84N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: Y84N

Domain	Start	End	E-Value	Type
SAM_PNT	47	131	1.36e-29	SMART
low complexity region	210	221	N/A	INTRINSIC
AT_hook	244	256	1.29e0	SMART
ETS	272	359	6.11e-49	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188895

Meta Mutation Damage Score

0.5298

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

99% (72/73)

MGI Phenotype

Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	A	G	1: 155,558,818	S61G	probably damaging	Het
Acot12	A	G	13: 91,784,397	N504S	probably benign	Het
Adcy3	C	T	12: 4,173,450		probably benign	Het
Adcyap1r1	A	T	6: 55,479,194	H168L	probably damaging	Het
Adgrd1	A	G	5: 129,129,001	E213G	probably benign	Het
Aldh1l2	G	T	10: 83,502,525	T510K	probably damaging	Het
Apol7e	A	T	15: 77,717,894	M231L	probably benign	Het
Asb1	C	A	1: 91,546,925		probably null	Het
Atf7ip2	C	T	16: 10,211,084	P160L	probably damaging	Het
Atp8a1	A	G	5: 67,738,429	L554P	probably damaging	Het
Ccdc18	A	T	5: 108,196,042	M884L	probably benign	Het
Ccdc93	A	G	1: 121,491,212	I499V	probably benign	Het
Ccl20	A	G	1: 83,117,895	D60G	probably damaging	Het
Cdhr3	T	C	12: 33,045,193	T626A	possibly damaging	Het
Cep250	A	G	2: 155,976,095	E789G	probably damaging	Het
Cmpk2	T	C	12: 26,474,047	L281P	probably damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Crocc	G	A	4: 141,018,736	R1691C	probably damaging	Het
Csf1	C	T	3: 107,748,279	V90M	probably damaging	Het
Cul2	T	G	18: 3,414,164	M86R	probably benign	Het
Dbndd2	T	C	2: 164,488,664	F79S	probably damaging	Het
Dkk1	G	T	19: 30,549,278	N34K	possibly damaging	Het
Dnah6	T	A	6: 73,181,762	L619F	probably benign	Het
Eif2b5	T	C	16: 20,507,037	V588A	probably damaging	Het
Fahd2a	T	C	2: 127,436,610	D272G	probably damaging	Het
Fbxw15	A	T	9: 109,558,203	C188*	probably null	Het
Fbxw8	T	C	5: 118,128,876	Y174C	probably benign	Het
Gnl1	C	A	17: 35,988,692	P585Q	possibly damaging	Het
Greb1l	T	C	18: 10,498,992	S292P	probably benign	Het
Gsk3b	G	A	16: 38,217,084		probably null	Het
Hcls1	C	T	16: 36,962,643	P452L	probably damaging	Het
Hdlbp	A	T	1: 93,422,285		probably benign	Het
Hecw1	A	G	13: 14,377,940	S25P	probably damaging	Het
Hells	T	C	19: 38,940,484	V100A	probably benign	Het
Isl1	C	T	13: 116,303,330	E161K	probably benign	Het
Klra9	G	T	6: 130,185,592	N160K	possibly damaging	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Mpc1	G	A	17: 8,296,878	R134Q	possibly damaging	Het
Myo5c	A	T	9: 75,292,241	N1377I	probably benign	Het
Myrf	T	C	19: 10,218,232	I607V	probably benign	Het
Olfr123	T	G	17: 37,796,184	S247A	probably benign	Het
Olfr968	A	T	9: 39,772,065	I245K	probably damaging	Het
Pik3c2b	A	G	1: 133,066,916	D206G	possibly damaging	Het
Pipox	A	G	11: 77,882,742	Y228H	probably damaging	Het
Pitrm1	T	A	13: 6,560,095	V401D	possibly damaging	Het
Plod1	C	T	4: 147,926,200	E265K	probably damaging	Het
Ptpn21	A	T	12: 98,680,405		probably null	Het
Qars	C	T	9: 108,514,083	Q7*	probably null	Het
Rpap2	T	A	5: 107,633,095	V479E	possibly damaging	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Rusc2	A	G	4: 43,421,749	Y723C	probably damaging	Het
Ryr2	A	T	13: 11,750,932	M1306K	probably benign	Het
Sesn3	A	C	9: 14,308,645	Y110S	probably damaging	Het
Sgce	C	T	6: 4,691,511	V319I	probably benign	Het
Slc15a5	G	T	6: 138,079,764	F51L	possibly damaging	Het
Slit2	T	A	5: 48,238,423	C723S	probably damaging	Het
Sncaip	A	G	18: 52,894,790		probably null	Het
Snx2	T	A	18: 53,197,878	D138E	probably damaging	Het
Spef2	A	T	15: 9,729,654	L126*	probably null	Het
Stam	T	C	2: 14,129,026	S195P	probably damaging	Het
Strn	T	C	17: 78,682,842	I82V	probably benign	Het
Synj2	T	A	17: 6,022,137	C202*	probably null	Het
Tecpr2	A	G	12: 110,933,247	D683G	probably benign	Het
Tfec	A	G	6: 16,835,308	V157A	probably damaging	Het
Tff1	T	G	17: 31,164,938	Q28P	probably benign	Het
Vmn2r86	A	G	10: 130,452,445	Y396H	probably damaging	Het
Vmn2r87	A	T	10: 130,471,960	M803K	probably damaging	Het
Vmn2r90	A	G	17: 17,733,304	K577E	probably damaging	Het
Vrk1	T	C	12: 106,036,540		probably benign	Het
Wdr20	A	G	12: 110,793,723	T348A	probably benign	Het

Other mutations in Elf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02141:Elf3	APN	1	135257707	missense	possibly damaging	0.94
IGL02470:Elf3	APN	1	135255012	missense	probably damaging	1.00
IGL03018:Elf3	APN	1	135256065	missense	possibly damaging	0.62
IGL03252:Elf3	APN	1	135254953	missense	probably damaging	1.00
P0026:Elf3	UTSW	1	135255973	critical splice donor site	probably null
R0087:Elf3	UTSW	1	135257137	missense	probably damaging	1.00
R1842:Elf3	UTSW	1	135256793	missense	possibly damaging	0.65
R2081:Elf3	UTSW	1	135257076	missense	probably benign	0.12
R4049:Elf3	UTSW	1	135254277	missense	probably benign	0.21
R4467:Elf3	UTSW	1	135256844	missense	probably damaging	1.00
R4630:Elf3	UTSW	1	135256740	intron	probably benign
R4715:Elf3	UTSW	1	135257752	missense	probably damaging	1.00
R4923:Elf3	UTSW	1	135256735	intron	probably benign
R5226:Elf3	UTSW	1	135257239	missense	probably benign	0.07
R5422:Elf3	UTSW	1	135255040	missense	probably damaging	0.98
R5706:Elf3	UTSW	1	135256482	missense	probably benign	0.01
R7115:Elf3	UTSW	1	135257118	missense	probably damaging	1.00
R7644:Elf3	UTSW	1	135256506	missense	possibly damaging	0.89
R7855:Elf3	UTSW	1	135254352	missense	probably damaging	1.00
R7940:Elf3	UTSW	1	135257128	missense	probably damaging	1.00
R8315:Elf3	UTSW	1	135256576	missense	probably benign	0.00
R8723:Elf3	UTSW	1	135257647	missense	possibly damaging	0.95
R8724:Elf3	UTSW	1	135254360	missense	probably damaging	1.00
R8906:Elf3	UTSW	1	135254940	missense	probably damaging	1.00
R8960:Elf3	UTSW	1	135255075	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCGTCACTGACCATGGTTC -3'
(R):5'- CTTGAGAACTAGCCATGTTGTGATTG -3'

Sequencing Primer
(F):5'- ACTGACCATGGTTCCGGCAG -3'
(R):5'- ATTGTGGATATGTATCTGTCCCTC -3'

Posted On

2014-06-30