Incidental Mutation 'R1897:Ccdc18'
ID 212038
Institutional Source Beutler Lab
Gene Symbol Ccdc18
Ensembl Gene ENSMUSG00000056531
Gene Name coiled-coil domain containing 18
Synonyms 4932411G06Rik, 1700021E15Rik
MMRRC Submission 039917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1897 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 108132875-108233628 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108196042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 884 (M884L)
Ref Sequence ENSEMBL: ENSMUSP00000036507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047677]
AlphaFold Q640L5
Predicted Effect probably benign
Transcript: ENSMUST00000047677
AA Change: M884L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036507
Gene: ENSMUSG00000056531
AA Change: M884L

DomainStartEndE-ValueType
coiled coil region 109 140 N/A INTRINSIC
coiled coil region 168 320 N/A INTRINSIC
coiled coil region 344 405 N/A INTRINSIC
coiled coil region 507 1307 N/A INTRINSIC
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,818 S61G probably damaging Het
Acot12 A G 13: 91,784,397 N504S probably benign Het
Adcy3 C T 12: 4,173,450 probably benign Het
Adcyap1r1 A T 6: 55,479,194 H168L probably damaging Het
Adgrd1 A G 5: 129,129,001 E213G probably benign Het
Aldh1l2 G T 10: 83,502,525 T510K probably damaging Het
Apol7e A T 15: 77,717,894 M231L probably benign Het
Asb1 C A 1: 91,546,925 probably null Het
Atf7ip2 C T 16: 10,211,084 P160L probably damaging Het
Atp8a1 A G 5: 67,738,429 L554P probably damaging Het
Ccdc93 A G 1: 121,491,212 I499V probably benign Het
Ccl20 A G 1: 83,117,895 D60G probably damaging Het
Cdhr3 T C 12: 33,045,193 T626A possibly damaging Het
Cep250 A G 2: 155,976,095 E789G probably damaging Het
Cmpk2 T C 12: 26,474,047 L281P probably damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Crocc G A 4: 141,018,736 R1691C probably damaging Het
Csf1 C T 3: 107,748,279 V90M probably damaging Het
Cul2 T G 18: 3,414,164 M86R probably benign Het
Dbndd2 T C 2: 164,488,664 F79S probably damaging Het
Dkk1 G T 19: 30,549,278 N34K possibly damaging Het
Dnah6 T A 6: 73,181,762 L619F probably benign Het
Eif2b5 T C 16: 20,507,037 V588A probably damaging Het
Elf3 A T 1: 135,257,137 Y104N probably damaging Het
Fahd2a T C 2: 127,436,610 D272G probably damaging Het
Fbxw15 A T 9: 109,558,203 C188* probably null Het
Fbxw8 T C 5: 118,128,876 Y174C probably benign Het
Gnl1 C A 17: 35,988,692 P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 S292P probably benign Het
Gsk3b G A 16: 38,217,084 probably null Het
Hcls1 C T 16: 36,962,643 P452L probably damaging Het
Hdlbp A T 1: 93,422,285 probably benign Het
Hecw1 A G 13: 14,377,940 S25P probably damaging Het
Hells T C 19: 38,940,484 V100A probably benign Het
Isl1 C T 13: 116,303,330 E161K probably benign Het
Klra9 G T 6: 130,185,592 N160K possibly damaging Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Mpc1 G A 17: 8,296,878 R134Q possibly damaging Het
Myo5c A T 9: 75,292,241 N1377I probably benign Het
Myrf T C 19: 10,218,232 I607V probably benign Het
Olfr123 T G 17: 37,796,184 S247A probably benign Het
Olfr968 A T 9: 39,772,065 I245K probably damaging Het
Pik3c2b A G 1: 133,066,916 D206G possibly damaging Het
Pipox A G 11: 77,882,742 Y228H probably damaging Het
Pitrm1 T A 13: 6,560,095 V401D possibly damaging Het
Plod1 C T 4: 147,926,200 E265K probably damaging Het
Ptpn21 A T 12: 98,680,405 probably null Het
Qars C T 9: 108,514,083 Q7* probably null Het
Rpap2 T A 5: 107,633,095 V479E possibly damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rusc2 A G 4: 43,421,749 Y723C probably damaging Het
Ryr2 A T 13: 11,750,932 M1306K probably benign Het
Sesn3 A C 9: 14,308,645 Y110S probably damaging Het
Sgce C T 6: 4,691,511 V319I probably benign Het
Slc15a5 G T 6: 138,079,764 F51L possibly damaging Het
Slit2 T A 5: 48,238,423 C723S probably damaging Het
Sncaip A G 18: 52,894,790 probably null Het
Snx2 T A 18: 53,197,878 D138E probably damaging Het
Spef2 A T 15: 9,729,654 L126* probably null Het
Stam T C 2: 14,129,026 S195P probably damaging Het
Strn T C 17: 78,682,842 I82V probably benign Het
Synj2 T A 17: 6,022,137 C202* probably null Het
Tecpr2 A G 12: 110,933,247 D683G probably benign Het
Tfec A G 6: 16,835,308 V157A probably damaging Het
Tff1 T G 17: 31,164,938 Q28P probably benign Het
Vmn2r86 A G 10: 130,452,445 Y396H probably damaging Het
Vmn2r87 A T 10: 130,471,960 M803K probably damaging Het
Vmn2r90 A G 17: 17,733,304 K577E probably damaging Het
Vrk1 T C 12: 106,036,540 probably benign Het
Wdr20 A G 12: 110,793,723 T348A probably benign Het
Other mutations in Ccdc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Ccdc18 APN 5 108180525 missense probably benign 0.01
IGL01380:Ccdc18 APN 5 108180887 missense probably damaging 0.96
IGL01405:Ccdc18 APN 5 108202186 splice site probably benign
IGL01718:Ccdc18 APN 5 108201348 missense possibly damaging 0.81
IGL02098:Ccdc18 APN 5 108202111 missense probably damaging 1.00
IGL02227:Ccdc18 APN 5 108148922 missense possibly damaging 0.89
IGL02391:Ccdc18 APN 5 108136052 missense probably damaging 1.00
IGL02794:Ccdc18 APN 5 108171748 missense probably benign 0.00
IGL02808:Ccdc18 APN 5 108135969 splice site probably benign
IGL02880:Ccdc18 APN 5 108135444 missense probably benign 0.31
IGL03069:Ccdc18 APN 5 108228901 missense probably damaging 1.00
IGL03390:Ccdc18 APN 5 108212131 missense probably damaging 1.00
PIT4402001:Ccdc18 UTSW 5 108158619 missense possibly damaging 0.94
R0004:Ccdc18 UTSW 5 108161700 missense possibly damaging 0.52
R0112:Ccdc18 UTSW 5 108173761 missense probably damaging 1.00
R0295:Ccdc18 UTSW 5 108173789 missense probably damaging 1.00
R0546:Ccdc18 UTSW 5 108174964 missense probably benign 0.06
R0619:Ccdc18 UTSW 5 108180416 missense probably benign 0.04
R0648:Ccdc18 UTSW 5 108135560 missense probably damaging 0.99
R0648:Ccdc18 UTSW 5 108174987 missense probably damaging 1.00
R0666:Ccdc18 UTSW 5 108163664 missense probably benign 0.19
R1271:Ccdc18 UTSW 5 108202116 nonsense probably null
R1509:Ccdc18 UTSW 5 108188978 missense possibly damaging 0.89
R1539:Ccdc18 UTSW 5 108191977 missense probably damaging 1.00
R1542:Ccdc18 UTSW 5 108212188 missense probably benign
R1663:Ccdc18 UTSW 5 108216090 missense probably damaging 1.00
R1865:Ccdc18 UTSW 5 108193802 missense probably benign 0.00
R1870:Ccdc18 UTSW 5 108220837 missense possibly damaging 0.90
R1946:Ccdc18 UTSW 5 108228995 missense probably damaging 1.00
R2420:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2421:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R2422:Ccdc18 UTSW 5 108228588 missense probably damaging 0.96
R4078:Ccdc18 UTSW 5 108158528 nonsense probably null
R4079:Ccdc18 UTSW 5 108158528 nonsense probably null
R4244:Ccdc18 UTSW 5 108148972 nonsense probably null
R4409:Ccdc18 UTSW 5 108220842 nonsense probably null
R4428:Ccdc18 UTSW 5 108136077 missense probably benign 0.01
R4455:Ccdc18 UTSW 5 108161529 missense possibly damaging 0.68
R4499:Ccdc18 UTSW 5 108228960 missense possibly damaging 0.62
R4612:Ccdc18 UTSW 5 108135441 missense probably benign 0.01
R4907:Ccdc18 UTSW 5 108136141 missense probably benign 0.01
R4972:Ccdc18 UTSW 5 108192003 missense probably benign
R5039:Ccdc18 UTSW 5 108158648 critical splice donor site probably null
R5835:Ccdc18 UTSW 5 108140874 missense possibly damaging 0.94
R5854:Ccdc18 UTSW 5 108206728 missense possibly damaging 0.79
R6128:Ccdc18 UTSW 5 108163759 missense possibly damaging 0.76
R6229:Ccdc18 UTSW 5 108171618 missense probably benign 0.00
R6271:Ccdc18 UTSW 5 108174887 missense possibly damaging 0.65
R6315:Ccdc18 UTSW 5 108161582 missense probably benign
R6359:Ccdc18 UTSW 5 108135525 missense probably damaging 1.00
R6375:Ccdc18 UTSW 5 108174954 missense possibly damaging 0.79
R6388:Ccdc18 UTSW 5 108201348 missense possibly damaging 0.81
R6415:Ccdc18 UTSW 5 108161746 missense probably benign 0.03
R6560:Ccdc18 UTSW 5 108191924 missense probably benign 0.09
R6645:Ccdc18 UTSW 5 108138930 missense probably benign
R6664:Ccdc18 UTSW 5 108168100 nonsense probably null
R6836:Ccdc18 UTSW 5 108197967 missense probably damaging 1.00
R6947:Ccdc18 UTSW 5 108161535 missense probably benign 0.26
R7009:Ccdc18 UTSW 5 108173862 critical splice donor site probably null
R7052:Ccdc18 UTSW 5 108161688 missense probably benign 0.15
R7058:Ccdc18 UTSW 5 108193798 missense probably benign
R7087:Ccdc18 UTSW 5 108196122 missense probably benign
R7117:Ccdc18 UTSW 5 108148969 missense possibly damaging 0.95
R7176:Ccdc18 UTSW 5 108168106 missense probably benign
R7382:Ccdc18 UTSW 5 108139007 missense probably damaging 1.00
R7477:Ccdc18 UTSW 5 108220850 missense probably damaging 0.98
R7493:Ccdc18 UTSW 5 108206617 nonsense probably null
R7506:Ccdc18 UTSW 5 108163739 missense possibly damaging 0.85
R7635:Ccdc18 UTSW 5 108229049 critical splice donor site probably null
R7690:Ccdc18 UTSW 5 108228662 missense probably benign 0.00
R7748:Ccdc18 UTSW 5 108149041 critical splice donor site probably null
R7812:Ccdc18 UTSW 5 108180833 missense probably benign 0.00
R8017:Ccdc18 UTSW 5 108228645 nonsense probably null
R8019:Ccdc18 UTSW 5 108228645 nonsense probably null
R8172:Ccdc18 UTSW 5 108163774 critical splice donor site probably null
R8177:Ccdc18 UTSW 5 108197795 missense possibly damaging 0.65
R8344:Ccdc18 UTSW 5 108161503 missense possibly damaging 0.88
R8351:Ccdc18 UTSW 5 108155797 missense probably damaging 1.00
R8415:Ccdc18 UTSW 5 108216033 missense probably damaging 1.00
R8451:Ccdc18 UTSW 5 108155797 missense probably damaging 1.00
R8547:Ccdc18 UTSW 5 108197859 missense probably damaging 1.00
R8725:Ccdc18 UTSW 5 108180417 missense possibly damaging 0.66
R9137:Ccdc18 UTSW 5 108148990 missense probably damaging 0.98
R9391:Ccdc18 UTSW 5 108228904 missense probably benign 0.02
R9418:Ccdc18 UTSW 5 108155803 missense probably damaging 1.00
R9536:Ccdc18 UTSW 5 108138926 missense probably benign 0.01
R9565:Ccdc18 UTSW 5 108191934 missense probably damaging 0.99
RF013:Ccdc18 UTSW 5 108220716 missense probably benign 0.05
X0024:Ccdc18 UTSW 5 108191922 missense probably benign 0.01
X0063:Ccdc18 UTSW 5 108212197 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACTGTCACGTGCTTATCC -3'
(R):5'- GGCCATTCTTATTCAAACCACC -3'

Sequencing Primer
(F):5'- AATAGGTGACTTAAAAATCTGAGTGG -3'
(R):5'- TTCTTATTCAAACCACCATACACAC -3'
Posted On 2014-06-30