Incidental Mutation 'R1897:Fbxw15'
ID212055
Institutional Source Beutler Lab
Gene Symbol Fbxw15
Ensembl Gene ENSMUSG00000074060
Gene NameF-box and WD-40 domain protein 15
SynonymsFbxo12J
MMRRC Submission 039917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1897 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109552602-109568262 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 109558203 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 188 (C188*)
Ref Sequence ENSEMBL: ENSMUSP00000142894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056745] [ENSMUST00000198112] [ENSMUST00000198397]
Predicted Effect probably null
Transcript: ENSMUST00000056745
AA Change: C241*
SMART Domains Protein: ENSMUSP00000058175
Gene: ENSMUSG00000074060
AA Change: C241*

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1flga_ 73 413 3e-7 SMART
Blast:WD40 137 176 5e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000198112
AA Change: C188*
SMART Domains Protein: ENSMUSP00000142894
Gene: ENSMUSG00000074060
AA Change: C188*

DomainStartEndE-ValueType
FBOX 8 45 2.1e-6 SMART
SCOP:d1tbga_ 73 196 3e-5 SMART
Blast:WD40 84 123 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000198397
SMART Domains Protein: ENSMUSP00000143385
Gene: ENSMUSG00000074060

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1tbga_ 116 240 1e-3 SMART
Blast:WD40 137 176 6e-6 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,818 S61G probably damaging Het
Acot12 A G 13: 91,784,397 N504S probably benign Het
Adcy3 C T 12: 4,173,450 probably benign Het
Adcyap1r1 A T 6: 55,479,194 H168L probably damaging Het
Adgrd1 A G 5: 129,129,001 E213G probably benign Het
Aldh1l2 G T 10: 83,502,525 T510K probably damaging Het
Apol7e A T 15: 77,717,894 M231L probably benign Het
Asb1 C A 1: 91,546,925 probably null Het
Atf7ip2 C T 16: 10,211,084 P160L probably damaging Het
Atp8a1 A G 5: 67,738,429 L554P probably damaging Het
Ccdc18 A T 5: 108,196,042 M884L probably benign Het
Ccdc93 A G 1: 121,491,212 I499V probably benign Het
Ccl20 A G 1: 83,117,895 D60G probably damaging Het
Cdhr3 T C 12: 33,045,193 T626A possibly damaging Het
Cep250 A G 2: 155,976,095 E789G probably damaging Het
Cmpk2 T C 12: 26,474,047 L281P probably damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Crocc G A 4: 141,018,736 R1691C probably damaging Het
Csf1 C T 3: 107,748,279 V90M probably damaging Het
Cul2 T G 18: 3,414,164 M86R probably benign Het
Dbndd2 T C 2: 164,488,664 F79S probably damaging Het
Dkk1 G T 19: 30,549,278 N34K possibly damaging Het
Dnah6 T A 6: 73,181,762 L619F probably benign Het
Eif2b5 T C 16: 20,507,037 V588A probably damaging Het
Elf3 A T 1: 135,257,137 Y104N probably damaging Het
Fahd2a T C 2: 127,436,610 D272G probably damaging Het
Fbxw8 T C 5: 118,128,876 Y174C probably benign Het
Gnl1 C A 17: 35,988,692 P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 S292P probably benign Het
Gsk3b G A 16: 38,217,084 probably null Het
Hcls1 C T 16: 36,962,643 P452L probably damaging Het
Hdlbp A T 1: 93,422,285 probably benign Het
Hecw1 A G 13: 14,377,940 S25P probably damaging Het
Hells T C 19: 38,940,484 V100A probably benign Het
Isl1 C T 13: 116,303,330 E161K probably benign Het
Klra9 G T 6: 130,185,592 N160K possibly damaging Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Mpc1 G A 17: 8,296,878 R134Q possibly damaging Het
Myo5c A T 9: 75,292,241 N1377I probably benign Het
Myrf T C 19: 10,218,232 I607V probably benign Het
Olfr123 T G 17: 37,796,184 S247A probably benign Het
Olfr968 A T 9: 39,772,065 I245K probably damaging Het
Pik3c2b A G 1: 133,066,916 D206G possibly damaging Het
Pipox A G 11: 77,882,742 Y228H probably damaging Het
Pitrm1 T A 13: 6,560,095 V401D possibly damaging Het
Plod1 C T 4: 147,926,200 E265K probably damaging Het
Ptpn21 A T 12: 98,680,405 probably null Het
Qars C T 9: 108,514,083 Q7* probably null Het
Rpap2 T A 5: 107,633,095 V479E possibly damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rusc2 A G 4: 43,421,749 Y723C probably damaging Het
Ryr2 A T 13: 11,750,932 M1306K probably benign Het
Sesn3 A C 9: 14,308,645 Y110S probably damaging Het
Sgce C T 6: 4,691,511 V319I probably benign Het
Slc15a5 G T 6: 138,079,764 F51L possibly damaging Het
Slit2 T A 5: 48,238,423 C723S probably damaging Het
Sncaip A G 18: 52,894,790 probably null Het
Snx2 T A 18: 53,197,878 D138E probably damaging Het
Spef2 A T 15: 9,729,654 L126* probably null Het
Stam T C 2: 14,129,026 S195P probably damaging Het
Strn T C 17: 78,682,842 I82V probably benign Het
Synj2 T A 17: 6,022,137 C202* probably null Het
Tecpr2 A G 12: 110,933,247 D683G probably benign Het
Tfec A G 6: 16,835,308 V157A probably damaging Het
Tff1 T G 17: 31,164,938 Q28P probably benign Het
Vmn2r86 A G 10: 130,452,445 Y396H probably damaging Het
Vmn2r87 A T 10: 130,471,960 M803K probably damaging Het
Vmn2r90 A G 17: 17,733,304 K577E probably damaging Het
Vrk1 T C 12: 106,036,540 probably benign Het
Wdr20 A G 12: 110,793,723 T348A probably benign Het
Other mutations in Fbxw15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02094:Fbxw15 APN 9 109558240 missense possibly damaging 0.87
IGL02239:Fbxw15 APN 9 109559837 missense probably benign 0.01
IGL02343:Fbxw15 APN 9 109552655 utr 3 prime probably benign
IGL02748:Fbxw15 APN 9 109558210 missense possibly damaging 0.66
IGL03206:Fbxw15 APN 9 109565362 missense possibly damaging 0.90
IGL03370:Fbxw15 APN 9 109555151 missense probably benign 0.00
lagging UTSW 9 109555673 splice site probably null
R0321:Fbxw15 UTSW 9 109565385 missense probably benign 0.03
R0742:Fbxw15 UTSW 9 109555556 splice site probably null
R1141:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1143:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1276:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1282:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1283:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1321:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1324:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1341:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1716:Fbxw15 UTSW 9 109557136 missense probably benign 0.00
R1750:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1757:Fbxw15 UTSW 9 109557279 missense probably damaging 0.99
R1765:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1799:Fbxw15 UTSW 9 109558246 missense probably damaging 0.99
R1826:Fbxw15 UTSW 9 109559714 splice site probably null
R2237:Fbxw15 UTSW 9 109555235 missense probably damaging 0.99
R2346:Fbxw15 UTSW 9 109565432 missense probably damaging 1.00
R4391:Fbxw15 UTSW 9 109568232 start gained probably benign
R4392:Fbxw15 UTSW 9 109568232 start gained probably benign
R4812:Fbxw15 UTSW 9 109559922 missense probably benign 0.01
R5198:Fbxw15 UTSW 9 109558174 missense probably benign 0.00
R5278:Fbxw15 UTSW 9 109555684 missense probably benign 0.03
R5541:Fbxw15 UTSW 9 109565430 missense probably benign 0.23
R5899:Fbxw15 UTSW 9 109555673 splice site probably null
R5975:Fbxw15 UTSW 9 109555252 missense probably damaging 1.00
R6065:Fbxw15 UTSW 9 109568178 missense probably damaging 1.00
R6285:Fbxw15 UTSW 9 109557166 missense probably benign 0.09
R7357:Fbxw15 UTSW 9 109558240 missense probably benign 0.28
R7781:Fbxw15 UTSW 9 109557262 missense possibly damaging 0.71
R8145:Fbxw15 UTSW 9 109555590 missense probably benign 0.01
R8182:Fbxw15 UTSW 9 109555710 missense probably benign 0.00
R8272:Fbxw15 UTSW 9 109559760 missense probably benign 0.18
R8713:Fbxw15 UTSW 9 109555599 missense possibly damaging 0.93
X0026:Fbxw15 UTSW 9 109558187 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGTGACTTTACTTATGATAGGGC -3'
(R):5'- GGCTGGTCACAACTTTGGATC -3'

Sequencing Primer
(F):5'- ACTTTACTTATGATAGGGCTTAGGAG -3'
(R):5'- CATTATTGGACTTGAAGACACAGTGG -3'
Posted On2014-06-30