Incidental Mutation 'R1897:Aldh1l2'
ID 212058
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms D330038I09Rik
MMRRC Submission 039917-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1897 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 83323314-83370004 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83338389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 510 (T510K)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably damaging
Transcript: ENSMUST00000020497
AA Change: T623K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: T623K

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect probably damaging
Transcript: ENSMUST00000146640
AA Change: T510K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: T510K

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.9249 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,434,564 (GRCm39) S61G probably damaging Het
Acot12 A G 13: 91,932,516 (GRCm39) N504S probably benign Het
Adcy3 C T 12: 4,223,450 (GRCm39) probably benign Het
Adcyap1r1 A T 6: 55,456,179 (GRCm39) H168L probably damaging Het
Adgrd1 A G 5: 129,206,065 (GRCm39) E213G probably benign Het
Apol7e A T 15: 77,602,094 (GRCm39) M231L probably benign Het
Asb1 C A 1: 91,474,647 (GRCm39) probably null Het
Atf7ip2 C T 16: 10,028,948 (GRCm39) P160L probably damaging Het
Atp8a1 A G 5: 67,895,772 (GRCm39) L554P probably damaging Het
Ccdc18 A T 5: 108,343,908 (GRCm39) M884L probably benign Het
Ccdc93 A G 1: 121,418,941 (GRCm39) I499V probably benign Het
Ccl20 A G 1: 83,095,616 (GRCm39) D60G probably damaging Het
Cdhr3 T C 12: 33,095,192 (GRCm39) T626A possibly damaging Het
Cep250 A G 2: 155,818,015 (GRCm39) E789G probably damaging Het
Cmpk2 T C 12: 26,524,046 (GRCm39) L281P probably damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Crocc G A 4: 140,746,047 (GRCm39) R1691C probably damaging Het
Csf1 C T 3: 107,655,595 (GRCm39) V90M probably damaging Het
Cul2 T G 18: 3,414,164 (GRCm39) M86R probably benign Het
Dbndd2 T C 2: 164,330,584 (GRCm39) F79S probably damaging Het
Dkk1 G T 19: 30,526,678 (GRCm39) N34K possibly damaging Het
Dnah6 T A 6: 73,158,745 (GRCm39) L619F probably benign Het
Eif2b5 T C 16: 20,325,787 (GRCm39) V588A probably damaging Het
Elf3 A T 1: 135,184,875 (GRCm39) Y104N probably damaging Het
Fahd2a T C 2: 127,278,530 (GRCm39) D272G probably damaging Het
Fbxw15 A T 9: 109,387,271 (GRCm39) C188* probably null Het
Fbxw8 T C 5: 118,266,941 (GRCm39) Y174C probably benign Het
Gnl1 C A 17: 36,299,584 (GRCm39) P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 (GRCm39) S292P probably benign Het
Gsk3b G A 16: 38,037,446 (GRCm39) probably null Het
Hcls1 C T 16: 36,783,005 (GRCm39) P452L probably damaging Het
Hdlbp A T 1: 93,350,007 (GRCm39) probably benign Het
Hecw1 A G 13: 14,552,525 (GRCm39) S25P probably damaging Het
Hells T C 19: 38,928,928 (GRCm39) V100A probably benign Het
Isl1 C T 13: 116,439,866 (GRCm39) E161K probably benign Het
Klra9 G T 6: 130,162,555 (GRCm39) N160K possibly damaging Het
Lama4 T C 10: 38,936,182 (GRCm39) V619A probably damaging Het
Mpc1 G A 17: 8,515,710 (GRCm39) R134Q possibly damaging Het
Myo5c A T 9: 75,199,523 (GRCm39) N1377I probably benign Het
Myrf T C 19: 10,195,596 (GRCm39) I607V probably benign Het
Or2g1 T G 17: 38,107,075 (GRCm39) S247A probably benign Het
Or8g53 A T 9: 39,683,361 (GRCm39) I245K probably damaging Het
Pik3c2b A G 1: 132,994,654 (GRCm39) D206G possibly damaging Het
Pipox A G 11: 77,773,568 (GRCm39) Y228H probably damaging Het
Pitrm1 T A 13: 6,610,131 (GRCm39) V401D possibly damaging Het
Plod1 C T 4: 148,010,657 (GRCm39) E265K probably damaging Het
Ptpn21 A T 12: 98,646,664 (GRCm39) probably null Het
Qars1 C T 9: 108,391,282 (GRCm39) Q7* probably null Het
Rpap2 T A 5: 107,780,961 (GRCm39) V479E possibly damaging Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Rusc2 A G 4: 43,421,749 (GRCm39) Y723C probably damaging Het
Ryr2 A T 13: 11,765,818 (GRCm39) M1306K probably benign Het
Sesn3 A C 9: 14,219,941 (GRCm39) Y110S probably damaging Het
Sgce C T 6: 4,691,511 (GRCm39) V319I probably benign Het
Slc15a5 G T 6: 138,056,762 (GRCm39) F51L possibly damaging Het
Slit2 T A 5: 48,395,765 (GRCm39) C723S probably damaging Het
Sncaip A G 18: 53,027,862 (GRCm39) probably null Het
Snx2 T A 18: 53,330,950 (GRCm39) D138E probably damaging Het
Spef2 A T 15: 9,729,740 (GRCm39) L126* probably null Het
Stam T C 2: 14,133,837 (GRCm39) S195P probably damaging Het
Strn T C 17: 78,990,271 (GRCm39) I82V probably benign Het
Synj2 T A 17: 6,072,412 (GRCm39) C202* probably null Het
Tecpr2 A G 12: 110,899,681 (GRCm39) D683G probably benign Het
Tfec A G 6: 16,835,307 (GRCm39) V157A probably damaging Het
Tff1 T G 17: 31,383,912 (GRCm39) Q28P probably benign Het
Vmn2r86 A G 10: 130,288,314 (GRCm39) Y396H probably damaging Het
Vmn2r87 A T 10: 130,307,829 (GRCm39) M803K probably damaging Het
Vmn2r90 A G 17: 17,953,566 (GRCm39) K577E probably damaging Het
Vrk1 T C 12: 106,002,799 (GRCm39) probably benign Het
Wdr20 A G 12: 110,760,157 (GRCm39) T348A probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83,358,750 (GRCm39) nonsense probably null
IGL01154:Aldh1l2 APN 10 83,356,237 (GRCm39) missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83,363,240 (GRCm39) missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83,328,531 (GRCm39) missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83,356,126 (GRCm39) splice site probably benign
IGL02179:Aldh1l2 APN 10 83,358,701 (GRCm39) missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83,331,759 (GRCm39) missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83,328,448 (GRCm39) nonsense probably null
IGL02727:Aldh1l2 APN 10 83,342,469 (GRCm39) missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83,358,777 (GRCm39) missense probably benign 0.17
Hunger_winter UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
Spartan UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83,358,710 (GRCm39) missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83,363,199 (GRCm39) missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83,358,551 (GRCm39) splice site probably benign
R0302:Aldh1l2 UTSW 10 83,356,229 (GRCm39) missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83,326,478 (GRCm39) missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83,354,542 (GRCm39) missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83,354,494 (GRCm39) splice site probably null
R0788:Aldh1l2 UTSW 10 83,352,028 (GRCm39) missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83,344,487 (GRCm39) missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83,331,889 (GRCm39) missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83,331,799 (GRCm39) missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83,356,234 (GRCm39) missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83,344,524 (GRCm39) missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83,343,946 (GRCm39) nonsense probably null
R1893:Aldh1l2 UTSW 10 83,328,400 (GRCm39) missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83,342,607 (GRCm39) missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83,363,177 (GRCm39) missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83,338,336 (GRCm39) missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83,348,228 (GRCm39) missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83,342,518 (GRCm39) missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83,331,784 (GRCm39) missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83,358,641 (GRCm39) missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83,349,486 (GRCm39) missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83,344,556 (GRCm39) missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83,363,271 (GRCm39) missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83,358,649 (GRCm39) missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83,337,789 (GRCm39) missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83,348,170 (GRCm39) missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83,356,189 (GRCm39) missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83,356,244 (GRCm39) missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83,343,998 (GRCm39) nonsense probably null
R6161:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83,329,288 (GRCm39) splice site probably null
R6189:Aldh1l2 UTSW 10 83,343,877 (GRCm39) critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83,350,408 (GRCm39) missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83,338,321 (GRCm39) missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83,343,969 (GRCm39) missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83,343,975 (GRCm39) missense probably benign
R7848:Aldh1l2 UTSW 10 83,335,707 (GRCm39) missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83,356,202 (GRCm39) missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83,326,479 (GRCm39) missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83,337,785 (GRCm39) missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83,342,506 (GRCm39) missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83,344,541 (GRCm39) missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83,342,545 (GRCm39) missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83,342,496 (GRCm39) missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83,342,510 (GRCm39) missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83,331,816 (GRCm39) nonsense probably null
R9784:Aldh1l2 UTSW 10 83,342,614 (GRCm39) critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83,369,869 (GRCm39) missense probably benign
Z1177:Aldh1l2 UTSW 10 83,329,344 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGACGAAGACTGCAGC -3'
(R):5'- TGGATGACCTTTGTGACCATTG -3'

Sequencing Primer
(F):5'- CGGGAAGCAGCACTGAGC -3'
(R):5'- CCCTAGGGTCACAGAGGCAATATG -3'
Posted On 2014-06-30