Incidental Mutation 'R0124:Syt6'
ID21207
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Namesynaptotagmin VI
Synonyms3110037A08Rik
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location103575231-103645569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103587526 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 269 (Y269C)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
Predicted Effect probably damaging
Transcript: ENSMUST00000090697
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: Y269C

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117221
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118117
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118563
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121834
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: Y269C

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably benign
Transcript: ENSMUST00000183637
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Meta Mutation Damage Score 0.9598 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103625626 missense probably damaging 0.98
IGL02944:Syt6 APN 3 103575549 unclassified probably benign
IGL03168:Syt6 APN 3 103587627 missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103575453 missense possibly damaging 0.91
R0587:Syt6 UTSW 3 103625571 missense probably damaging 0.99
R0601:Syt6 UTSW 3 103620890 missense probably damaging 1.00
R1262:Syt6 UTSW 3 103585340 critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103587420 missense probably benign 0.21
R4012:Syt6 UTSW 3 103625493 splice site probably benign
R4450:Syt6 UTSW 3 103585645 missense probably benign 0.01
R4493:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4494:Syt6 UTSW 3 103585630 missense probably damaging 0.99
R4495:Syt6 UTSW 3 103587560 nonsense probably null
R4740:Syt6 UTSW 3 103625656 missense probably damaging 1.00
R4750:Syt6 UTSW 3 103630917 makesense probably null
R5668:Syt6 UTSW 3 103620901 missense probably damaging 1.00
R6185:Syt6 UTSW 3 103585528 missense probably damaging 1.00
R6660:Syt6 UTSW 3 103625644 missense probably damaging 1.00
R7120:Syt6 UTSW 3 103587357 missense probably damaging 1.00
R7307:Syt6 UTSW 3 103587472 missense probably damaging 1.00
R7501:Syt6 UTSW 3 103587702 missense probably benign 0.01
Z1177:Syt6 UTSW 3 103645115 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGGCCGTATCAAGCCTGAGC -3'
(R):5'- AGAGATTGTCCAGGATGACCTCCC -3'

Sequencing Primer
(F):5'- CGTATCAAGCCTGAGCTTTACAAG -3'
(R):5'- GGATGACCTCCCCAATCATGTC -3'
Posted On2013-04-11