Incidental Mutation 'R0124:Syt6'
ID 21207
Institutional Source Beutler Lab
Gene Symbol Syt6
Ensembl Gene ENSMUSG00000027849
Gene Name synaptotagmin VI
Synonyms 3110037A08Rik
MMRRC Submission 038409-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.123) question?
Stock # R0124 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 3
Chromosomal Location 103482561-103552883 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103494842 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 269 (Y269C)
Ref Sequence ENSEMBL: ENSMUSP00000112997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090697] [ENSMUST00000117221] [ENSMUST00000118117] [ENSMUST00000118563] [ENSMUST00000121834] [ENSMUST00000132325] [ENSMUST00000136049] [ENSMUST00000151985] [ENSMUST00000183637]
AlphaFold Q9R0N8
Predicted Effect probably damaging
Transcript: ENSMUST00000090697
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088196
Gene: ENSMUSG00000027849
AA Change: Y269C

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117221
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113373
Gene: ENSMUSG00000027849
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118117
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112486
Gene: ENSMUSG00000027849
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
C2 293 407 2.25e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118563
AA Change: Y184C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113287
Gene: ENSMUSG00000027849
AA Change: Y184C

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
C2 161 265 2.65e-20 SMART
Pfam:C2 294 332 3.5e-2 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121834
AA Change: Y269C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112997
Gene: ENSMUSG00000027849
AA Change: Y269C

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 93 103 N/A INTRINSIC
C2 246 350 2.65e-20 SMART
C2 378 492 2.25e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132325
SMART Domains Protein: ENSMUSP00000116324
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136049
SMART Domains Protein: ENSMUSP00000118124
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151985
Predicted Effect probably benign
Transcript: ENSMUST00000183637
SMART Domains Protein: ENSMUSP00000138874
Gene: ENSMUSG00000027849

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
Meta Mutation Damage Score 0.9598 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the synaptotagmin family. Synaptotagmins share a common domain structure that includes a transmembrane domain and a cytoplasmic region composed of 2 C2 domains, and are involved in calcium-dependent exocytosis of synaptic vesicles. This protein has been shown to be a key component of the secretory machinery involved in acrosomal exocytosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,138,656 (GRCm39) T194A probably benign Het
Afap1 C T 5: 36,102,553 (GRCm39) P82S probably damaging Het
Ankrd28 A G 14: 31,449,698 (GRCm39) Y481H probably damaging Het
Arid1b C T 17: 5,389,605 (GRCm39) T1717I probably damaging Het
Atad2b A G 12: 5,002,676 (GRCm39) K348R probably benign Het
Bcl3 C T 7: 19,543,576 (GRCm39) V5M probably damaging Het
C2cd3 A G 7: 100,118,725 (GRCm39) E2321G probably benign Het
Casq1 C T 1: 172,037,992 (GRCm39) V380M probably damaging Het
Cd209e T A 8: 3,901,274 (GRCm39) T127S probably benign Het
Cdh23 G T 10: 60,143,835 (GRCm39) Y2921* probably null Het
Cdh6 A G 15: 13,034,410 (GRCm39) L750P probably damaging Het
Cdk12 T C 11: 98,102,073 (GRCm39) probably benign Het
Ces5a T C 8: 94,255,183 (GRCm39) E170G probably damaging Het
Clec4f A G 6: 83,629,335 (GRCm39) probably null Het
Col19a1 T C 1: 24,565,539 (GRCm39) N264S unknown Het
Col2a1 T A 15: 97,896,743 (GRCm39) I43F unknown Het
Col4a2 A G 8: 11,458,871 (GRCm39) probably benign Het
Csmd3 T A 15: 47,454,112 (GRCm39) D3578V probably damaging Het
Cyp2c37 T C 19: 39,982,546 (GRCm39) L128P probably damaging Het
Dennd2b A G 7: 109,141,718 (GRCm39) S132P possibly damaging Het
Dysf A G 6: 84,042,084 (GRCm39) probably benign Het
Eml1 T C 12: 108,472,867 (GRCm39) V225A probably benign Het
Eml1 A G 12: 108,475,437 (GRCm39) Y256C probably damaging Het
Epb41l5 T A 1: 119,561,370 (GRCm39) K64* probably null Het
Fat2 A G 11: 55,174,504 (GRCm39) F2070L probably damaging Het
Fbxw18 G T 9: 109,520,583 (GRCm39) H259N probably benign Het
Gm10764 A T 10: 87,126,610 (GRCm39) T6S unknown Het
Gm14412 A G 2: 177,007,705 (GRCm39) probably benign Het
Heatr5b A T 17: 79,133,646 (GRCm39) probably benign Het
Hid1 T C 11: 115,247,649 (GRCm39) T250A probably damaging Het
Hnf4g A G 3: 3,708,142 (GRCm39) probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Lrriq1 C T 10: 103,006,281 (GRCm39) probably null Het
Map3k13 A G 16: 21,722,506 (GRCm39) T223A possibly damaging Het
Matn2 C T 15: 34,426,297 (GRCm39) probably benign Het
Myo6 A G 9: 80,215,056 (GRCm39) E1253G probably damaging Het
Nomo1 G T 7: 45,732,652 (GRCm39) probably benign Het
Or1ak2 A T 2: 36,827,268 (GRCm39) I46F possibly damaging Het
Or4c116 A T 2: 88,942,088 (GRCm39) I256K possibly damaging Het
Or8a1b A G 9: 37,622,759 (GRCm39) V272A possibly damaging Het
Papolg C T 11: 23,817,535 (GRCm39) A582T probably benign Het
Plekhm3 C T 1: 64,960,910 (GRCm39) E449K probably damaging Het
Pole T G 5: 110,451,858 (GRCm39) M900R probably damaging Het
Ppp1cb T A 5: 32,640,822 (GRCm39) probably benign Het
Pramel17 A G 4: 101,692,570 (GRCm39) *477Q probably null Het
Pros1 A G 16: 62,734,309 (GRCm39) T372A possibly damaging Het
Scara3 A T 14: 66,168,670 (GRCm39) S316T probably benign Het
Stau2 C T 1: 16,533,352 (GRCm39) A61T probably damaging Het
Stx3 T C 19: 11,769,163 (GRCm39) E54G possibly damaging Het
Sun1 T C 5: 139,232,434 (GRCm39) probably benign Het
Swt1 A T 1: 151,267,280 (GRCm39) C634S probably damaging Het
Tfap2a G A 13: 40,870,887 (GRCm39) probably benign Het
Tmx4 A T 2: 134,481,640 (GRCm39) probably null Het
Ttc39d T C 17: 80,524,375 (GRCm39) C345R probably damaging Het
Vmn1r27 T C 6: 58,192,233 (GRCm39) Y257C probably damaging Het
Vmn2r27 T A 6: 124,208,578 (GRCm39) T56S probably benign Het
Vps13b T C 15: 35,576,674 (GRCm39) probably null Het
Wdr17 A G 8: 55,088,526 (GRCm39) S1175P probably damaging Het
Wsb2 T C 5: 117,501,823 (GRCm39) F63L probably benign Het
Zfp142 A G 1: 74,607,782 (GRCm39) Y1561H probably damaging Het
Other mutations in Syt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Syt6 APN 3 103,532,942 (GRCm39) missense probably damaging 0.98
IGL02944:Syt6 APN 3 103,482,865 (GRCm39) unclassified probably benign
IGL03168:Syt6 APN 3 103,494,943 (GRCm39) missense probably damaging 1.00
PIT4305001:Syt6 UTSW 3 103,482,769 (GRCm39) missense possibly damaging 0.91
R0587:Syt6 UTSW 3 103,532,887 (GRCm39) missense probably damaging 0.99
R0601:Syt6 UTSW 3 103,528,206 (GRCm39) missense probably damaging 1.00
R1262:Syt6 UTSW 3 103,492,656 (GRCm39) critical splice acceptor site probably null
R1970:Syt6 UTSW 3 103,494,736 (GRCm39) missense probably benign 0.21
R4012:Syt6 UTSW 3 103,532,809 (GRCm39) splice site probably benign
R4450:Syt6 UTSW 3 103,492,961 (GRCm39) missense probably benign 0.01
R4493:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4494:Syt6 UTSW 3 103,492,946 (GRCm39) missense probably damaging 0.99
R4495:Syt6 UTSW 3 103,494,876 (GRCm39) nonsense probably null
R4740:Syt6 UTSW 3 103,532,972 (GRCm39) missense probably damaging 1.00
R4750:Syt6 UTSW 3 103,538,233 (GRCm39) makesense probably null
R5668:Syt6 UTSW 3 103,528,217 (GRCm39) missense probably damaging 1.00
R6185:Syt6 UTSW 3 103,492,844 (GRCm39) missense probably damaging 1.00
R6660:Syt6 UTSW 3 103,532,960 (GRCm39) missense probably damaging 1.00
R7120:Syt6 UTSW 3 103,494,673 (GRCm39) missense probably damaging 1.00
R7307:Syt6 UTSW 3 103,494,788 (GRCm39) missense probably damaging 1.00
R7501:Syt6 UTSW 3 103,495,018 (GRCm39) missense probably benign 0.01
R8768:Syt6 UTSW 3 103,492,850 (GRCm39) missense probably benign
R8867:Syt6 UTSW 3 103,534,371 (GRCm39) missense possibly damaging 0.91
R8885:Syt6 UTSW 3 103,532,941 (GRCm39) missense probably benign 0.06
R9068:Syt6 UTSW 3 103,494,825 (GRCm39) nonsense probably null
R9098:Syt6 UTSW 3 103,492,895 (GRCm39) missense probably damaging 0.96
R9361:Syt6 UTSW 3 103,482,679 (GRCm39) unclassified probably benign
Z1177:Syt6 UTSW 3 103,552,431 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- ATTGGCCGTATCAAGCCTGAGC -3'
(R):5'- AGAGATTGTCCAGGATGACCTCCC -3'

Sequencing Primer
(F):5'- CGTATCAAGCCTGAGCTTTACAAG -3'
(R):5'- GGATGACCTCCCCAATCATGTC -3'
Posted On 2013-04-11