Mutagenetix > Incidental Mutations

Incidental Mutation 'R1897:Greb1l'

212088

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

039917-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1897 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10498992 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 292 (S292P)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]

Predicted Effect

probably benign
Transcript: ENSMUST00000048977
AA Change: S292P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: S292P

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532
AA Change: S292P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: S292P

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173356

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224958

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

99% (72/73)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd6	A	G	1: 155,558,818	S61G	probably damaging	Het
Acot12	A	G	13: 91,784,397	N504S	probably benign	Het
Adcy3	C	T	12: 4,173,450		probably benign	Het
Adcyap1r1	A	T	6: 55,479,194	H168L	probably damaging	Het
Adgrd1	A	G	5: 129,129,001	E213G	probably benign	Het
Aldh1l2	G	T	10: 83,502,525	T510K	probably damaging	Het
Apol7e	A	T	15: 77,717,894	M231L	probably benign	Het
Asb1	C	A	1: 91,546,925		probably null	Het
Atf7ip2	C	T	16: 10,211,084	P160L	probably damaging	Het
Atp8a1	A	G	5: 67,738,429	L554P	probably damaging	Het
Ccdc18	A	T	5: 108,196,042	M884L	probably benign	Het
Ccdc93	A	G	1: 121,491,212	I499V	probably benign	Het
Ccl20	A	G	1: 83,117,895	D60G	probably damaging	Het
Cdhr3	T	C	12: 33,045,193	T626A	possibly damaging	Het
Cep250	A	G	2: 155,976,095	E789G	probably damaging	Het
Cmpk2	T	C	12: 26,474,047	L281P	probably damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Crocc	G	A	4: 141,018,736	R1691C	probably damaging	Het
Csf1	C	T	3: 107,748,279	V90M	probably damaging	Het
Cul2	T	G	18: 3,414,164	M86R	probably benign	Het
Dbndd2	T	C	2: 164,488,664	F79S	probably damaging	Het
Dkk1	G	T	19: 30,549,278	N34K	possibly damaging	Het
Dnah6	T	A	6: 73,181,762	L619F	probably benign	Het
Eif2b5	T	C	16: 20,507,037	V588A	probably damaging	Het
Elf3	A	T	1: 135,257,137	Y104N	probably damaging	Het
Fahd2a	T	C	2: 127,436,610	D272G	probably damaging	Het
Fbxw15	A	T	9: 109,558,203	C188*	probably null	Het
Fbxw8	T	C	5: 118,128,876	Y174C	probably benign	Het
Gnl1	C	A	17: 35,988,692	P585Q	possibly damaging	Het
Gsk3b	G	A	16: 38,217,084		probably null	Het
Hcls1	C	T	16: 36,962,643	P452L	probably damaging	Het
Hdlbp	A	T	1: 93,422,285		probably benign	Het
Hecw1	A	G	13: 14,377,940	S25P	probably damaging	Het
Hells	T	C	19: 38,940,484	V100A	probably benign	Het
Isl1	C	T	13: 116,303,330	E161K	probably benign	Het
Klra9	G	T	6: 130,185,592	N160K	possibly damaging	Het
Lama4	T	C	10: 39,060,186	V619A	probably damaging	Het
Mpc1	G	A	17: 8,296,878	R134Q	possibly damaging	Het
Myo5c	A	T	9: 75,292,241	N1377I	probably benign	Het
Myrf	T	C	19: 10,218,232	I607V	probably benign	Het
Olfr123	T	G	17: 37,796,184	S247A	probably benign	Het
Olfr968	A	T	9: 39,772,065	I245K	probably damaging	Het
Pik3c2b	A	G	1: 133,066,916	D206G	possibly damaging	Het
Pipox	A	G	11: 77,882,742	Y228H	probably damaging	Het
Pitrm1	T	A	13: 6,560,095	V401D	possibly damaging	Het
Plod1	C	T	4: 147,926,200	E265K	probably damaging	Het
Ptpn21	A	T	12: 98,680,405		probably null	Het
Qars	C	T	9: 108,514,083	Q7*	probably null	Het
Rpap2	T	A	5: 107,633,095	V479E	possibly damaging	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Rusc2	A	G	4: 43,421,749	Y723C	probably damaging	Het
Ryr2	A	T	13: 11,750,932	M1306K	probably benign	Het
Sesn3	A	C	9: 14,308,645	Y110S	probably damaging	Het
Sgce	C	T	6: 4,691,511	V319I	probably benign	Het
Slc15a5	G	T	6: 138,079,764	F51L	possibly damaging	Het
Slit2	T	A	5: 48,238,423	C723S	probably damaging	Het
Sncaip	A	G	18: 52,894,790		probably null	Het
Snx2	T	A	18: 53,197,878	D138E	probably damaging	Het
Spef2	A	T	15: 9,729,654	L126*	probably null	Het
Stam	T	C	2: 14,129,026	S195P	probably damaging	Het
Strn	T	C	17: 78,682,842	I82V	probably benign	Het
Synj2	T	A	17: 6,022,137	C202*	probably null	Het
Tecpr2	A	G	12: 110,933,247	D683G	probably benign	Het
Tfec	A	G	6: 16,835,308	V157A	probably damaging	Het
Tff1	T	G	17: 31,164,938	Q28P	probably benign	Het
Vmn2r86	A	G	10: 130,452,445	Y396H	probably damaging	Het
Vmn2r87	A	T	10: 130,471,960	M803K	probably damaging	Het
Vmn2r90	A	G	17: 17,733,304	K577E	probably damaging	Het
Vrk1	T	C	12: 106,036,540		probably benign	Het
Wdr20	A	G	12: 110,793,723	T348A	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGTTTTATGCAACTAGGCTG -3'
(R):5'- CCGGGTTCATTGAGAGATTCTG -3'

Sequencing Primer
(F):5'- ATGCAACTAGGCTGTCCTATCTG -3'
(R):5'- CTGTTTCTAAGGATAATGTAGAGGGC -3'

Posted On

2014-06-30