Mutagenetix > Incidental Mutations

Incidental Mutation 'R1898:Ttll4'

212096

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

039918-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R1898 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74697482 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1122 (D1122G)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678]

Predicted Effect

probably benign
Transcript: ENSMUST00000042125
AA Change: D1122G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: D1122G

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000113678
AA Change: D1058G

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: D1058G

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128891

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143790

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145132

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.9%

Validation Efficiency

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	T	C	19: 29,735,132	N789S	possibly damaging	Het
Abca1	C	A	4: 53,071,977	R1195L	probably benign	Het
Abca14	A	G	7: 120,251,169	Y748C	probably damaging	Het
Abca6	A	G	11: 110,208,799	F974S	probably damaging	Het
Acyp1	T	C	12: 85,288,340	K2E	probably benign	Het
Ahcy	T	A	2: 155,062,253	S355C	probably benign	Het
AI182371	A	G	2: 35,100,649	V12A	probably damaging	Het
Ankrd36	T	C	11: 5,575,683	I215T	probably benign	Het
Aox1	C	T	1: 58,078,442	R828C	probably damaging	Het
Atp1a4	T	A	1: 172,235,048	I631F	probably damaging	Het
Brinp3	T	G	1: 146,901,249	V478G	possibly damaging	Het
Cadm2	G	A	16: 66,815,383	S106L	probably damaging	Het
Celf2	C	T	2: 6,604,164	V95M	probably damaging	Het
Chka	A	T	19: 3,892,205	E404D	probably damaging	Het
Clec5a	A	C	6: 40,581,936	V72G	probably benign	Het
Cnn1	T	C	9: 22,101,264		probably null	Het
Coq6	A	G	12: 84,366,963	E89G	probably benign	Het
Cpne6	A	T	14: 55,517,028	I538F	possibly damaging	Het
Crx	G	A	7: 15,868,223	P177S	probably damaging	Het
Cysltr2	G	T	14: 73,029,533	P246T	probably damaging	Het
Decr1	A	G	4: 15,929,801	I164T	probably damaging	Het
Dmtf1	A	T	5: 9,128,091	V315E	probably damaging	Het
Dnah7b	A	G	1: 46,236,714	N2587S	probably benign	Het
E2f6	C	A	12: 16,824,580	T221K	probably benign	Het
Fat3	T	G	9: 15,960,130	D3655A	probably damaging	Het
Fbxw28	G	A	9: 109,323,384	T384I	probably benign	Het
Fes	T	A	7: 80,379,911	I608F	probably damaging	Het
Flnc	G	A	6: 29,438,666	W186*	probably null	Het
Gabrb2	A	G	11: 42,593,832	K239E	possibly damaging	Het
Gen1	T	C	12: 11,241,608	R727G	probably benign	Het
Glb1	T	A	9: 114,424,035	V184E	probably damaging	Het
Gngt1	A	T	6: 3,996,724	I57F	possibly damaging	Het
Ice1	T	C	13: 70,602,307	I87V	possibly damaging	Het
Itih1	A	G	14: 30,932,287	Y674H	probably benign	Het
Itsn1	T	A	16: 91,899,580	C24S	probably damaging	Het
Loxl1	A	G	9: 58,297,678	V418A	probably damaging	Het
Myh10	A	G	11: 68,771,906	N595S	probably damaging	Het
Myo5c	C	T	9: 75,297,626	T1587I	probably damaging	Het
Npat	T	A	9: 53,563,637	F910I	probably damaging	Het
Nradd	T	C	9: 110,621,608	Y167C	probably damaging	Het
Nt5dc1	T	C	10: 34,313,635	E352G	probably benign	Het
Numa1	T	C	7: 101,992,720		probably null	Het
Odc1	T	A	12: 17,548,841	S241T	probably damaging	Het
Olfr128	A	T	17: 37,923,625	N20Y	possibly damaging	Het
Olfr744	A	T	14: 50,618,774	D184V	probably damaging	Het
Pcnx3	T	C	19: 5,672,587	D951G	probably damaging	Het
Pigg	T	C	5: 108,336,542	F685L	probably benign	Het
Pnpla7	T	A	2: 25,053,784		probably benign	Het
Pramef25	C	T	4: 143,950,728	V94M	probably damaging	Het
Rcsd1	C	T	1: 165,659,429	A72T	probably benign	Het
Rp1l1	A	T	14: 64,031,590	T1542S	probably benign	Het
Sct	A	T	7: 141,278,848	L57Q	probably damaging	Het
Serpinb3b	T	C	1: 107,154,587	S316G	possibly damaging	Het
Shprh	T	C	10: 11,186,869	L1240S	probably damaging	Het
Slc4a1	C	T	11: 102,350,307	E924K	probably damaging	Het
Sp7	A	T	15: 102,359,018	Y118N	possibly damaging	Het
Srebf2	A	G	15: 82,203,735	T219A	probably damaging	Het
Tenm3	G	T	8: 48,310,761	P753T	probably damaging	Het
Tonsl	A	T	15: 76,638,853		probably null	Het
Trio	A	T	15: 27,742,380	S2675T	possibly damaging	Het
Tspan12	T	C	6: 21,795,694	T166A	probably damaging	Het
Vmn1r77	G	A	7: 12,041,623	A41T	probably damaging	Het
Xpo7	A	T	14: 70,695,624	F276Y	probably benign	Het
Zdhhc1	A	T	8: 105,478,746		probably null	Het
Zfp319	C	A	8: 95,328,789	C262F	probably damaging	Het
Zfp442	C	T	2: 150,408,662	C383Y	probably damaging	Het
Zfp57	G	T	17: 37,009,758	R168L	possibly damaging	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R6963:Ttll4	UTSW	1	74681816	missense	probably damaging	1.00
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCCCAGATCATGACAGTAAGAGG -3'
(R):5'- TCCCTTGAGGTAGCTGAGTG -3'

Sequencing Primer
(F):5'- AGAATCTGCAGCCACATC -3'
(R):5'- TCACAGCAGTCAAGCGG -3'

Posted On

2014-06-30