Incidental Mutation 'R1898:Ttll4'
ID212096
Institutional Source Beutler Lab
Gene Symbol Ttll4
Ensembl Gene ENSMUSG00000033257
Gene Nametubulin tyrosine ligase-like family, member 4
Synonyms4632407P03Rik
MMRRC Submission 039918-MU
Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74661745-74703730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74697482 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1122 (D1122G)
Ref Sequence ENSEMBL: ENSMUSP00000037406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678]
Predicted Effect probably benign
Transcript: ENSMUST00000042125
AA Change: D1122G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: D1122G

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 645 940 2.2e-106 PFAM
low complexity region 942 961 N/A INTRINSIC
low complexity region 1103 1113 N/A INTRINSIC
low complexity region 1168 1182 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113678
AA Change: D1058G
SMART Domains Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: D1058G

DomainStartEndE-ValueType
low complexity region 504 544 N/A INTRINSIC
Pfam:TTL 636 876 3.4e-82 PFAM
low complexity region 878 897 N/A INTRINSIC
low complexity region 1039 1049 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145132
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Ttll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Ttll4 APN 1 74685893 missense probably damaging 1.00
IGL01743:Ttll4 APN 1 74688193 missense possibly damaging 0.63
IGL01914:Ttll4 APN 1 74679058 missense probably benign 0.01
IGL02288:Ttll4 APN 1 74679401 missense probably benign 0.05
IGL02621:Ttll4 APN 1 74687484 missense probably damaging 1.00
IGL02662:Ttll4 APN 1 74687231 unclassified probably null
IGL02890:Ttll4 APN 1 74687339 nonsense probably null
IGL02937:Ttll4 APN 1 74679503 missense possibly damaging 0.92
IGL03178:Ttll4 APN 1 74680408 missense probably damaging 0.96
IGL03412:Ttll4 APN 1 74687321 missense probably benign 0.28
1mM(1):Ttll4 UTSW 1 74689980 missense probably null 1.00
R0083:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0108:Ttll4 UTSW 1 74679769 missense probably benign 0.13
R0135:Ttll4 UTSW 1 74679928 missense possibly damaging 0.86
R0137:Ttll4 UTSW 1 74679692 missense possibly damaging 0.74
R0306:Ttll4 UTSW 1 74696757 missense probably benign 0.28
R0506:Ttll4 UTSW 1 74688618 missense probably benign 0.06
R0555:Ttll4 UTSW 1 74688280 missense probably damaging 1.00
R1617:Ttll4 UTSW 1 74679401 missense probably benign 0.05
R1649:Ttll4 UTSW 1 74697470 missense possibly damaging 0.52
R1793:Ttll4 UTSW 1 74687840 missense possibly damaging 0.91
R1952:Ttll4 UTSW 1 74687559 missense probably damaging 0.99
R1987:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R1989:Ttll4 UTSW 1 74685368 missense possibly damaging 0.81
R2067:Ttll4 UTSW 1 74680382 missense possibly damaging 0.94
R2162:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R2185:Ttll4 UTSW 1 74679829 missense possibly damaging 0.54
R2875:Ttll4 UTSW 1 74686438 unclassified probably null
R2876:Ttll4 UTSW 1 74686438 unclassified probably null
R2895:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R2896:Ttll4 UTSW 1 74685358 missense possibly damaging 0.92
R3157:Ttll4 UTSW 1 74697611 missense possibly damaging 0.81
R3832:Ttll4 UTSW 1 74686391 missense probably damaging 1.00
R4707:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4784:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R4785:Ttll4 UTSW 1 74679007 missense possibly damaging 0.62
R5176:Ttll4 UTSW 1 74679286 missense probably damaging 0.99
R5202:Ttll4 UTSW 1 74687852 critical splice donor site probably null
R5244:Ttll4 UTSW 1 74696448 missense probably benign 0.30
R5264:Ttll4 UTSW 1 74686376 missense possibly damaging 0.92
R5452:Ttll4 UTSW 1 74679321 missense probably benign 0.06
R5992:Ttll4 UTSW 1 74685391 missense probably damaging 1.00
R6111:Ttll4 UTSW 1 74697539 missense possibly damaging 0.95
R6722:Ttll4 UTSW 1 74681789 missense possibly damaging 0.95
R6776:Ttll4 UTSW 1 74681353 missense probably damaging 1.00
R6815:Ttll4 UTSW 1 74679349 missense possibly damaging 0.89
R6836:Ttll4 UTSW 1 74689413 missense probably damaging 0.98
R6963:Ttll4 UTSW 1 74681816 missense probably damaging 1.00
R7271:Ttll4 UTSW 1 74688661 missense possibly damaging 0.83
R7508:Ttll4 UTSW 1 74687259 missense possibly damaging 0.81
R7714:Ttll4 UTSW 1 74679413 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCAGATCATGACAGTAAGAGG -3'
(R):5'- TCCCTTGAGGTAGCTGAGTG -3'

Sequencing Primer
(F):5'- AGAATCTGCAGCCACATC -3'
(R):5'- TCACAGCAGTCAAGCGG -3'
Posted On2014-06-30