Incidental Mutation 'R0124:Afap1'
ID21210
Institutional Source Beutler Lab
Gene Symbol Afap1
Ensembl Gene ENSMUSG00000029094
Gene Nameactin filament associated protein 1
Synonyms
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location35893319-36003923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35945209 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 82 (P82S)
Ref Sequence ENSEMBL: ENSMUSP00000119364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064571] [ENSMUST00000141824]
Predicted Effect probably damaging
Transcript: ENSMUST00000064571
AA Change: P82S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067779
Gene: ENSMUSG00000029094
AA Change: P82S

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:PH 21 110 9e-9 BLAST
low complexity region 112 130 N/A INTRINSIC
PH 153 250 2.26e-12 SMART
low complexity region 314 335 N/A INTRINSIC
PH 349 444 3.48e-13 SMART
coiled coil region 557 649 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141824
AA Change: P82S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119364
Gene: ENSMUSG00000029094
AA Change: P82S

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:PH 21 110 7e-9 BLAST
low complexity region 112 130 N/A INTRINSIC
PH 153 250 2.26e-12 SMART
low complexity region 314 335 N/A INTRINSIC
PH 349 444 3.48e-13 SMART
coiled coil region 557 627 N/A INTRINSIC
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Src binding partner. It may represent a potential modulator of actin filament integrity in response to cellular signals, and may function as an adaptor protein by linking Src family members and/or other signaling proteins to actin filaments. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit inability to nurse pups due to failed secretory activation, reduced milk lipid synthesis and precocious mammary gland involution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Afap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Afap1 APN 5 35968708 missense probably damaging 0.99
IGL01730:Afap1 APN 5 35962239 missense probably damaging 1.00
IGL01798:Afap1 APN 5 35935682 critical splice donor site probably null
IGL02188:Afap1 APN 5 35936077 missense probably benign 0.00
IGL03027:Afap1 APN 5 35961750 missense probably benign 0.00
R0485:Afap1 UTSW 5 35951003 missense probably damaging 0.99
R0532:Afap1 UTSW 5 35968600 missense possibly damaging 0.86
R0891:Afap1 UTSW 5 35961852 splice site probably null
R1370:Afap1 UTSW 5 35935600 missense unknown
R1378:Afap1 UTSW 5 35968686 missense probably damaging 1.00
R1443:Afap1 UTSW 5 35968661 missense probably damaging 1.00
R1470:Afap1 UTSW 5 35961737 splice site probably benign
R1536:Afap1 UTSW 5 35974491 missense probably damaging 1.00
R2357:Afap1 UTSW 5 35984274 missense probably damaging 1.00
R4737:Afap1 UTSW 5 35961782 missense probably benign 0.03
R5251:Afap1 UTSW 5 35950892 missense probably damaging 1.00
R5918:Afap1 UTSW 5 35974525 missense possibly damaging 0.60
R5936:Afap1 UTSW 5 35974396 missense possibly damaging 0.67
R6008:Afap1 UTSW 5 35997551 missense probably damaging 0.99
R6009:Afap1 UTSW 5 35997560 missense probably damaging 1.00
R6155:Afap1 UTSW 5 35935609 missense unknown
R7058:Afap1 UTSW 5 35962260 missense probably benign 0.00
R7320:Afap1 UTSW 5 35948223 missense probably damaging 0.98
R7799:Afap1 UTSW 5 35974398 missense possibly damaging 0.67
R7946:Afap1 UTSW 5 35935651 missense probably benign 0.30
R7946:Afap1 UTSW 5 35984052 splice site probably null
R8358:Afap1 UTSW 5 35974486 missense probably benign 0.30
R8446:Afap1 UTSW 5 35987301 missense
R8785:Afap1 UTSW 5 35950960 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGATCTATGACCAGCCAGGGTG -3'
(R):5'- AGAACAGTTTCTCTCCCGACCTCAG -3'

Sequencing Primer
(F):5'- GCCAGGGTGAGGCTGAG -3'
(R):5'- AAATGCCTTCCTTAGATCCCAG -3'
Posted On2013-04-11