Incidental Mutation 'R1898:Ahcy'
ID212106
Institutional Source Beutler Lab
Gene Symbol Ahcy
Ensembl Gene ENSMUSG00000027597
Gene NameS-adenosylhomocysteine hydrolase
SynonymsCuBP, SAHH
MMRRC Submission 039918-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155059310-155074497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155062253 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 355 (S355C)
Ref Sequence ENSEMBL: ENSMUSP00000061851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054607] [ENSMUST00000137242]
Predicted Effect probably benign
Transcript: ENSMUST00000054607
AA Change: S355C

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061851
Gene: ENSMUSG00000027597
AA Change: S355C

DomainStartEndE-ValueType
AdoHcyase 6 431 N/A SMART
AdoHcyase_NAD 191 352 1.49e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137242
SMART Domains Protein: ENSMUSP00000116774
Gene: ENSMUSG00000027597

DomainStartEndE-ValueType
Pfam:AdoHcyase 5 95 1.4e-43 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] S-adenosylhomocysteine hydrolase belongs to the adenosylhomocysteinase family. It catalyzes the reversible hydrolysis of S-adenosylhomocysteine (AdoHcy) to adenosine (Ado) and L-homocysteine (Hcy). Thus, it regulates the intracellular S-adenosylhomocysteine (SAH) concentration thought to be important for transmethylation reactions. Deficiency in this protein is one of the different causes of hypermethioninemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: See the ax allele for a deletion that includes the Ahcy gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Ahcy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Ahcy APN 2 155067361 missense probably benign 0.26
IGL03001:Ahcy APN 2 155064828 missense probably damaging 1.00
F5770:Ahcy UTSW 2 155064921 nonsense probably null
R1226:Ahcy UTSW 2 155064897 missense probably benign 0.01
R1572:Ahcy UTSW 2 155068931 missense probably benign 0.06
R1741:Ahcy UTSW 2 155064234 missense probably benign 0.29
R1879:Ahcy UTSW 2 155064152 critical splice donor site probably null
R4743:Ahcy UTSW 2 155068968 missense probably damaging 1.00
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R4861:Ahcy UTSW 2 155060516 missense probably benign 0.05
R6114:Ahcy UTSW 2 155062159 missense probably damaging 1.00
R7107:Ahcy UTSW 2 155068973 missense probably damaging 0.98
V7582:Ahcy UTSW 2 155064921 nonsense probably null
X0067:Ahcy UTSW 2 155068952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGGACTCTGGATGACAAC -3'
(R):5'- CATTCCAGGCCATCTCGTGAAG -3'

Sequencing Primer
(F):5'- CTCTGGATGACAACTAAGAAGGC -3'
(R):5'- CCATCTCGTGAAGCATGGGAG -3'
Posted On2014-06-30