Mutagenetix > Incidental Mutation

Incidental Mutation 'R0124:Pole'

21211

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

MMRRC Submission

038409-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0124 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 110303992 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Arginine at position 900 (M900R)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296]

AlphaFold

Q9WVF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000007296
AA Change: M900R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: M900R

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131887

Meta Mutation Damage Score

0.4337

Coding Region Coverage

1x: 99.3%
3x: 98.3%
10x: 95.7%
20x: 89.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,161,674	T194A	probably benign	Het
Afap1	C	T	5: 35,945,209	P82S	probably damaging	Het
Ankrd28	A	G	14: 31,727,741	Y481H	probably damaging	Het
Arid1b	C	T	17: 5,339,330	T1717I	probably damaging	Het
Atad2b	A	G	12: 4,952,676	K348R	probably benign	Het
B020004J07Rik	A	G	4: 101,835,373	*477Q	probably null	Het
Bcl3	C	T	7: 19,809,651	V5M	probably damaging	Het
C2cd3	A	G	7: 100,469,518	E2321G	probably benign	Het
Casq1	C	T	1: 172,210,425	V380M	probably damaging	Het
Cd209e	T	A	8: 3,851,274	T127S	probably benign	Het
Cdh23	G	T	10: 60,308,056	Y2921*	probably null	Het
Cdh6	A	G	15: 13,034,324	L750P	probably damaging	Het
Cdk12	T	C	11: 98,211,247		probably benign	Het
Ces5a	T	C	8: 93,528,555	E170G	probably damaging	Het
Clec4f	A	G	6: 83,652,353		probably null	Het
Col19a1	T	C	1: 24,526,458	N264S	unknown	Het
Col2a1	T	A	15: 97,998,862	I43F	unknown	Het
Col4a2	A	G	8: 11,408,871		probably benign	Het
Csmd3	T	A	15: 47,590,716	D3578V	probably damaging	Het
Cyp2c37	T	C	19: 39,994,102	L128P	probably damaging	Het
Dysf	A	G	6: 84,065,102		probably benign	Het
Eml1	T	C	12: 108,506,608	V225A	probably benign	Het
Eml1	A	G	12: 108,509,178	Y256C	probably damaging	Het
Epb41l5	T	A	1: 119,633,640	K64*	probably null	Het
Fat2	A	G	11: 55,283,678	F2070L	probably damaging	Het
Fbxw18	G	T	9: 109,691,515	H259N	probably benign	Het
Gm10764	A	T	10: 87,290,748	T6S	unknown	Het
Gm14412	A	G	2: 177,315,912		probably benign	Het
Heatr5b	A	T	17: 78,826,217		probably benign	Het
Hid1	T	C	11: 115,356,823	T250A	probably damaging	Het
Hnf4g	A	G	3: 3,643,082		probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Lrriq1	C	T	10: 103,170,420		probably null	Het
Map3k13	A	G	16: 21,903,756	T223A	possibly damaging	Het
Matn2	C	T	15: 34,426,151		probably benign	Het
Myo6	A	G	9: 80,307,774	E1253G	probably damaging	Het
Nomo1	G	T	7: 46,083,228		probably benign	Het
Olfr1221	A	T	2: 89,111,744	I256K	possibly damaging	Het
Olfr160	A	G	9: 37,711,463	V272A	possibly damaging	Het
Olfr356	A	T	2: 36,937,256	I46F	possibly damaging	Het
Papolg	C	T	11: 23,867,535	A582T	probably benign	Het
Plekhm3	C	T	1: 64,921,751	E449K	probably damaging	Het
Ppp1cb	T	A	5: 32,483,478		probably benign	Het
Pros1	A	G	16: 62,913,946	T372A	possibly damaging	Het
Scara3	A	T	14: 65,931,221	S316T	probably benign	Het
St5	A	G	7: 109,542,511	S132P	possibly damaging	Het
Stau2	C	T	1: 16,463,128	A61T	probably damaging	Het
Stx3	T	C	19: 11,791,799	E54G	possibly damaging	Het
Sun1	T	C	5: 139,246,679		probably benign	Het
Swt1	A	T	1: 151,391,529	C634S	probably damaging	Het
Syt6	A	G	3: 103,587,526	Y269C	probably damaging	Het
Tfap2a	G	A	13: 40,717,411		probably benign	Het
Tmx4	A	T	2: 134,639,720		probably null	Het
Ttc39d	T	C	17: 80,216,946	C345R	probably damaging	Het
Vmn1r27	T	C	6: 58,215,248	Y257C	probably damaging	Het
Vmn2r27	T	A	6: 124,231,619	T56S	probably benign	Het
Vps13b	T	C	15: 35,576,528		probably null	Het
Wdr17	A	G	8: 54,635,491	S1175P	probably damaging	Het
Wsb2	T	C	5: 117,363,758	F63L	probably benign	Het
Zfp142	A	G	1: 74,568,623	Y1561H	probably damaging	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5817:Pole	UTSW	5	110312972	missense	probably damaging	1.00
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R5990:Pole	UTSW	5	110302144	missense	probably damaging	1.00
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6019:Pole	UTSW	5	110324515	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6988:Pole	UTSW	5	110329583	missense	probably damaging	0.97
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8001:Pole	UTSW	5	110312734	missense	probably damaging	1.00
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9018:Pole	UTSW	5	110289809	missense	probably benign	0.37
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
R9626:Pole	UTSW	5	110312093	missense	possibly damaging	0.68
R9676:Pole	UTSW	5	110295565	missense	probably benign	0.00
R9720:Pole	UTSW	5	110337043	missense	probably benign	0.01
R9787:Pole	UTSW	5	110318000	critical splice donor site	probably null
R9794:Pole	UTSW	5	110318335	missense	probably benign	0.01
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAAATTCCACCTTAGTTCTGTCC -3'
(R):5'- ccaagccatagctccaCTCTTCTTTAGT -3'

Sequencing Primer
(F):5'- AACACCTGGCTTCTAAGGACTTG -3'
(R):5'- GCAAGTTGAATCTAACAGTCTTACC -3'

Posted On

2013-04-11