Incidental Mutation 'R1898:Slc4a1'
ID212144
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Namesolute carrier family 4 (anion exchanger), member 1
SynonymsAe1, CD233, l11Jus51, band 3, Empb3, erythrocyte membrane protein band 3
MMRRC Submission 039918-MU
Accession Numbers

Genbank: NM_011403; MGI: 109393

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102348824-102366203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102350307 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 924 (E924K)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
Predicted Effect probably damaging
Transcript: ENSMUST00000006749
AA Change: E924K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: E924K

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102357964 missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102353903 missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102354333 missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102356267 missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102359146 critical splice acceptor site probably null
Rumor UTSW 11 102361222 nonsense probably null
A5278:Slc4a1 UTSW 11 102353815 splice site probably benign
R0011:Slc4a1 UTSW 11 102357110 missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102352684 missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102354366 missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102357915 splice site probably benign
R0635:Slc4a1 UTSW 11 102352672 missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102361171 missense probably benign
R1816:Slc4a1 UTSW 11 102351230 missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102356830 missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102359302 missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102357193 missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102357121 missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102361419 utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102356258 missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102352453 missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102351503 missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102353261 missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102361383 missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102359077 missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102358254 missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102350314 missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102353266 missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102356525 missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102352531 missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102356735 missense probably damaging 0.99
R6629:Slc4a1 UTSW 11 102361222 nonsense probably null
R6717:Slc4a1 UTSW 11 102354423 missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102356258 missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102353867 missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102356484 missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102361419 start gained probably benign
R7582:Slc4a1 UTSW 11 102352577 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTGCAAGAGACTGTGACCC -3'
(R):5'- ACCAACTCTGTACTCTAGGGAC -3'

Sequencing Primer
(F):5'- GAGACTGTGACCCCAATTCCCTG -3'
(R):5'- ACTCTGTACTCTAGGGACAGCAG -3'
Posted On2014-06-30