Incidental Mutation 'R0124:1700003E16Rik'
ID21215
Institutional Source Beutler Lab
Gene Symbol 1700003E16Rik
Ensembl Gene ENSMUSG00000030030
Gene NameRIKEN cDNA 1700003E16 gene
Synonyms
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.753) question?
Stock #R0124 (G1)
Quality Score208
Status Validated (trace)
Chromosome6
Chromosomal Location83156404-83162945 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83161674 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 194 (T194A)
Ref Sequence ENSEMBL: ENSMUSP00000032106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000077407] [ENSMUST00000113913] [ENSMUST00000130212] [ENSMUST00000203203]
Predicted Effect probably benign
Transcript: ENSMUST00000032106
AA Change: T194A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030
AA Change: T194A

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077407
SMART Domains Protein: ENSMUSP00000076623
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
SCOP:d1fxkc_ 185 337 3e-3 SMART
low complexity region 363 379 N/A INTRINSIC
Pfam:Dynactin 489 768 8.2e-91 PFAM
low complexity region 800 820 N/A INTRINSIC
coiled coil region 914 1009 N/A INTRINSIC
low complexity region 1025 1043 N/A INTRINSIC
coiled coil region 1143 1172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113913
SMART Domains Protein: ENSMUSP00000109546
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 118 139 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 168 197 N/A INTRINSIC
SCOP:d1fxkc_ 205 357 3e-3 SMART
low complexity region 383 399 N/A INTRINSIC
Pfam:Dynactin 509 788 2.5e-90 PFAM
low complexity region 820 840 N/A INTRINSIC
coiled coil region 934 1029 N/A INTRINSIC
low complexity region 1051 1069 N/A INTRINSIC
coiled coil region 1168 1197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130212
SMART Domains Protein: ENSMUSP00000115838
Gene: ENSMUSG00000031865

DomainStartEndE-ValueType
CAP_GLY 12 78 5.52e-31 SMART
low complexity region 124 147 N/A INTRINSIC
low complexity region 148 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154953
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in 1700003E16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:1700003E16Rik APN 6 83162788 unclassified probably null
IGL02616:1700003E16Rik APN 6 83161662 missense probably benign
IGL03171:1700003E16Rik APN 6 83162395 missense possibly damaging 0.73
IGL03196:1700003E16Rik APN 6 83161063 missense probably damaging 1.00
R1081:1700003E16Rik UTSW 6 83162020 missense probably benign
R1184:1700003E16Rik UTSW 6 83160912 missense probably damaging 1.00
R1522:1700003E16Rik UTSW 6 83162586 missense probably damaging 0.96
R4361:1700003E16Rik UTSW 6 83162706 missense probably damaging 0.99
R4688:1700003E16Rik UTSW 6 83162698 missense probably damaging 0.99
R5326:1700003E16Rik UTSW 6 83161354 missense probably damaging 0.99
R6007:1700003E16Rik UTSW 6 83160918 missense possibly damaging 0.80
R7212:1700003E16Rik UTSW 6 83161672 missense probably benign 0.00
R7343:1700003E16Rik UTSW 6 83162371 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCGTTCCATTCACCATTAGCCAG -3'
(R):5'- AGGTGTGAGCCGAAGGATGATTCC -3'

Sequencing Primer
(F):5'- ATGCACTACGGATTCCTGG -3'
(R):5'- AAGGATGATTCCTTCTCAGAGGC -3'
Posted On2013-04-11