Incidental Mutation 'R1898:Ice1'
ID212152
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Nameinteractor of little elongation complex ELL subunit 1
SynonymsBC018507
MMRRC Submission 039918-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location70551707-70637634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70602307 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 87 (I87V)
Ref Sequence ENSEMBL: ENSMUSP00000152818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: I1887V

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: I1887V

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220637
AA Change: I87V

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 intron probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGCTTAACACATCCAGAGAG -3'
(R):5'- CTAAAAGACTGCGCCTGGAC -3'

Sequencing Primer
(F):5'- GAGAAAGAAAAGTTGCCACCTAC -3'
(R):5'- TGCGCCTGGACAACAAGTC -3'
Posted On2014-06-30