Incidental Mutation 'R1898:Ice1'
ID 212152
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 039918-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R1898 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70750426 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 87 (I87V)
Ref Sequence ENSEMBL: ENSMUSP00000152818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: I1887V

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: I1887V

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000220637
AA Change: I87V

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,071,977 (GRCm39) R1195L probably benign Het
Abca14 A G 7: 119,850,392 (GRCm39) Y748C probably damaging Het
Abca6 A G 11: 110,099,625 (GRCm39) F974S probably damaging Het
Acyp1 T C 12: 85,335,114 (GRCm39) K2E probably benign Het
Ahcy T A 2: 154,904,173 (GRCm39) S355C probably benign Het
AI182371 A G 2: 34,990,661 (GRCm39) V12A probably damaging Het
Ankrd36 T C 11: 5,525,683 (GRCm39) I215T probably benign Het
Aox1 C T 1: 58,117,601 (GRCm39) R828C probably damaging Het
Atp1a4 T A 1: 172,062,615 (GRCm39) I631F probably damaging Het
Brd10 T C 19: 29,712,532 (GRCm39) N789S possibly damaging Het
Brinp3 T G 1: 146,776,987 (GRCm39) V478G possibly damaging Het
Cadm2 G A 16: 66,612,271 (GRCm39) S106L probably damaging Het
Celf2 C T 2: 6,608,975 (GRCm39) V95M probably damaging Het
Chka A T 19: 3,942,205 (GRCm39) E404D probably damaging Het
Clec5a A C 6: 40,558,870 (GRCm39) V72G probably benign Het
Cnn1 T C 9: 22,012,560 (GRCm39) probably null Het
Coq6 A G 12: 84,413,737 (GRCm39) E89G probably benign Het
Cpne6 A T 14: 55,754,485 (GRCm39) I538F possibly damaging Het
Crx G A 7: 15,602,148 (GRCm39) P177S probably damaging Het
Cysltr2 G T 14: 73,266,973 (GRCm39) P246T probably damaging Het
Decr1 A G 4: 15,929,801 (GRCm39) I164T probably damaging Het
Dmtf1 A T 5: 9,178,091 (GRCm39) V315E probably damaging Het
Dnah7b A G 1: 46,275,874 (GRCm39) N2587S probably benign Het
E2f6 C A 12: 16,874,581 (GRCm39) T221K probably benign Het
Fat3 T G 9: 15,871,426 (GRCm39) D3655A probably damaging Het
Fbxw28 G A 9: 109,152,452 (GRCm39) T384I probably benign Het
Fes T A 7: 80,029,659 (GRCm39) I608F probably damaging Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Gabrb2 A G 11: 42,484,659 (GRCm39) K239E possibly damaging Het
Gen1 T C 12: 11,291,609 (GRCm39) R727G probably benign Het
Glb1 T A 9: 114,253,103 (GRCm39) V184E probably damaging Het
Gngt1 A T 6: 3,996,724 (GRCm39) I57F possibly damaging Het
Itih1 A G 14: 30,654,244 (GRCm39) Y674H probably benign Het
Itsn1 T A 16: 91,696,468 (GRCm39) C24S probably damaging Het
Loxl1 A G 9: 58,204,961 (GRCm39) V418A probably damaging Het
Myh10 A G 11: 68,662,732 (GRCm39) N595S probably damaging Het
Myo5c C T 9: 75,204,908 (GRCm39) T1587I probably damaging Het
Npat T A 9: 53,474,937 (GRCm39) F910I probably damaging Het
Nradd T C 9: 110,450,676 (GRCm39) Y167C probably damaging Het
Nt5dc1 T C 10: 34,189,631 (GRCm39) E352G probably benign Het
Numa1 T C 7: 101,641,927 (GRCm39) probably null Het
Odc1 T A 12: 17,598,842 (GRCm39) S241T probably damaging Het
Or11g2 A T 14: 50,856,231 (GRCm39) D184V probably damaging Het
Or14j7 A T 17: 38,234,516 (GRCm39) N20Y possibly damaging Het
Pcnx3 T C 19: 5,722,615 (GRCm39) D951G probably damaging Het
Pigg T C 5: 108,484,408 (GRCm39) F685L probably benign Het
Pnpla7 T A 2: 24,943,796 (GRCm39) probably benign Het
Pramel16 C T 4: 143,677,298 (GRCm39) V94M probably damaging Het
Rcsd1 C T 1: 165,486,998 (GRCm39) A72T probably benign Het
Rp1l1 A T 14: 64,269,039 (GRCm39) T1542S probably benign Het
Sct A T 7: 140,858,761 (GRCm39) L57Q probably damaging Het
Serpinb3b T C 1: 107,082,317 (GRCm39) S316G possibly damaging Het
Shprh T C 10: 11,062,613 (GRCm39) L1240S probably damaging Het
Slc4a1 C T 11: 102,241,133 (GRCm39) E924K probably damaging Het
Sp7 A T 15: 102,267,453 (GRCm39) Y118N possibly damaging Het
Srebf2 A G 15: 82,087,936 (GRCm39) T219A probably damaging Het
Tenm3 G T 8: 48,763,796 (GRCm39) P753T probably damaging Het
Tonsl A T 15: 76,523,053 (GRCm39) probably null Het
Trio A T 15: 27,742,466 (GRCm39) S2675T possibly damaging Het
Tspan12 T C 6: 21,795,693 (GRCm39) T166A probably damaging Het
Ttll4 A G 1: 74,736,641 (GRCm39) D1122G probably benign Het
Vmn1r77 G A 7: 11,775,550 (GRCm39) A41T probably damaging Het
Xpo7 A T 14: 70,933,064 (GRCm39) F276Y probably benign Het
Zdhhc1 A T 8: 106,205,378 (GRCm39) probably null Het
Zfp319 C A 8: 96,055,417 (GRCm39) C262F probably damaging Het
Zfp442 C T 2: 150,250,582 (GRCm39) C383Y probably damaging Het
Zfp57 G T 17: 37,320,650 (GRCm39) R168L possibly damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGCTTAACACATCCAGAGAG -3'
(R):5'- CTAAAAGACTGCGCCTGGAC -3'

Sequencing Primer
(F):5'- GAGAAAGAAAAGTTGCCACCTAC -3'
(R):5'- TGCGCCTGGACAACAAGTC -3'
Posted On 2014-06-30