Incidental Mutation 'R1898:Itih1'
ID212153
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 039918-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30932287 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 674 (Y674H)
Ref Sequence ENSEMBL: ENSMUSP00000126449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect probably benign
Transcript: ENSMUST00000006704
AA Change: Y678H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: Y678H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163118
AA Change: Y674H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: Y674H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R7717:Itih1 UTSW 14 30931185 missense probably damaging 1.00
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAAGTGGACAGTATGCAAGGC -3'
(R):5'- CGTTTGTGCTGTCAGCCATAC -3'

Sequencing Primer
(F):5'- GGAGTGAAAGCTACCCCAATAGTTTC -3'
(R):5'- TGCTGTCAGCCATACAGCCATC -3'
Posted On2014-06-30