Incidental Mutation 'R1901:Nav1'
ID212175
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 135472410 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 474 (N474T)
Ref Sequence ENSEMBL: ENSMUSP00000140322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect probably benign
Transcript: ENSMUST00000040599
AA Change: N474T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: N474T

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067414
AA Change: N474T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: N474T

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190130
Predicted Effect probably benign
Transcript: ENSMUST00000190298
AA Change: N474T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: N474T

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acacb A T 5: 114,165,734 R73* probably null Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Aldh3b3 T C 19: 3,965,130 Y170H probably damaging Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
Golga1 A T 2: 39,047,780 probably null Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Olfr685 A G 7: 105,180,872 I162T possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Scn11a T A 9: 119,779,036 K1010* probably null Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spata18 T A 5: 73,671,139 F348I probably damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1895:Nav1 UTSW 1 135458658 missense probably damaging 1.00
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2110:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3690:Nav1 UTSW 1 135467644 missense probably benign 0.11
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5834:Nav1 UTSW 1 135532406 missense probably benign 0.07
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
R7001:Nav1 UTSW 1 135454611 splice site probably null
R7185:Nav1 UTSW 1 135471008 missense possibly damaging 0.85
R7291:Nav1 UTSW 1 135465859 missense probably damaging 1.00
R7361:Nav1 UTSW 1 135452853 missense unknown
R7390:Nav1 UTSW 1 135584918 missense probably benign 0.01
R7464:Nav1 UTSW 1 135584909 missense probably benign 0.03
R7502:Nav1 UTSW 1 135469666 missense probably damaging 1.00
R7601:Nav1 UTSW 1 135460438 missense unknown
R7625:Nav1 UTSW 1 135467745 missense probably damaging 1.00
R7639:Nav1 UTSW 1 135471122 missense probably benign 0.09
R7786:Nav1 UTSW 1 135469995 missense probably damaging 1.00
R7808:Nav1 UTSW 1 135452248 missense unknown
R7815:Nav1 UTSW 1 135584639 missense possibly damaging 0.49
R7825:Nav1 UTSW 1 135450044 missense probably damaging 0.98
R8030:Nav1 UTSW 1 135537239 missense probably damaging 1.00
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Z1176:Nav1 UTSW 1 135452886 missense unknown
Z1176:Nav1 UTSW 1 135472420 missense probably damaging 1.00
Z1177:Nav1 UTSW 1 135469731 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTTTCAAGGACCCTGGGTG -3'
(R):5'- GAGACAGTATTTTCCCACCCC -3'

Sequencing Primer
(F):5'- GGTGTCCCAGGCTGATGG -3'
(R):5'- CACCCCACCTATCTAGAATGATAG -3'
Posted On2014-06-30