Incidental Mutation 'R1901:Golga1'
ID212181
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 39047780 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000149810] [ENSMUST00000149810] [ENSMUST00000184996]
Predicted Effect probably null
Transcript: ENSMUST00000039165
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112850
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136261
Predicted Effect probably null
Transcript: ENSMUST00000149810
SMART Domains Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
coiled coil region 70 183 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149810
SMART Domains Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
coiled coil region 70 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153914
Predicted Effect probably benign
Transcript: ENSMUST00000184996
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acacb A T 5: 114,165,734 R73* probably null Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Aldh3b3 T C 19: 3,965,130 Y170H probably damaging Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Olfr685 A G 7: 105,180,872 I162T possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Scn11a T A 9: 119,779,036 K1010* probably null Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spata18 T A 5: 73,671,139 F348I probably damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0167:Golga1 UTSW 2 39047648 missense probably benign 0.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0443:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0906:Golga1 UTSW 2 39047643 missense probably damaging 0.99
R1508:Golga1 UTSW 2 39023249 missense probably benign
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 splice site probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
R7067:Golga1 UTSW 2 39047719 missense probably benign 0.00
R7816:Golga1 UTSW 2 39052098 missense probably damaging 1.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers
Posted On2014-06-30