Incidental Mutation 'R1901:Snrnp40'
ID 212189
Institutional Source Beutler Lab
Gene Symbol Snrnp40
Ensembl Gene ENSMUSG00000074088
Gene Name small nuclear ribonucleoprotein 40 (U5)
Synonyms Wdr57, 0610009C03Rik
MMRRC Submission 039921-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1901 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 130253925-130283819 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 130279768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 295 (S295T)
Ref Sequence ENSEMBL: ENSMUSP00000101616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105994]
AlphaFold Q6PE01
Predicted Effect probably damaging
Transcript: ENSMUST00000105994
AA Change: S295T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101616
Gene: ENSMUSG00000074088
AA Change: S295T

DomainStartEndE-ValueType
low complexity region 24 45 N/A INTRINSIC
WD40 56 95 1.64e-9 SMART
WD40 99 138 1.83e-7 SMART
WD40 141 181 8.68e-9 SMART
WD40 184 222 3.81e-5 SMART
WD40 225 264 3.24e-8 SMART
WD40 271 314 5.1e-6 SMART
WD40 317 356 2.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181560
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the U5 small nuclear ribonucleoprotein (snRNP) particle. The U5 snRNP is part of the spliceosome, a multiprotein complex that catalyzes the removal of introns from pre-messenger RNAs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 119,945,322 (GRCm39) E466G probably damaging Het
Acacb A T 5: 114,303,795 (GRCm39) R73* probably null Het
Acta1 A T 8: 124,619,900 (GRCm39) S147T probably benign Het
Adh1 G A 3: 137,994,558 (GRCm39) V293I probably benign Het
Aldh3b3 T C 19: 4,015,130 (GRCm39) Y170H probably damaging Het
Ank3 A T 10: 69,658,167 (GRCm39) T198S probably damaging Het
Ankrd12 A T 17: 66,293,698 (GRCm39) N578K possibly damaging Het
Ano2 A T 6: 125,849,647 (GRCm39) E126D probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cfap44 A C 16: 44,242,737 (GRCm39) T714P probably benign Het
Cnot1 T C 8: 96,469,749 (GRCm39) I1369V possibly damaging Het
Col19a1 A T 1: 24,576,078 (GRCm39) I88K unknown Het
Col1a1 G A 11: 94,837,458 (GRCm39) probably null Het
Col5a1 A G 2: 27,850,456 (GRCm39) T518A unknown Het
Cul7 T C 17: 46,966,666 (GRCm39) L365P probably damaging Het
Dlec1 T C 9: 118,931,712 (GRCm39) S44P probably damaging Het
Dock9 T C 14: 121,862,565 (GRCm39) probably null Het
Fbxl9 T C 8: 106,039,707 (GRCm39) N556S probably damaging Het
Flrt2 C A 12: 95,745,904 (GRCm39) P81T probably damaging Het
Flrt2 C T 12: 95,745,905 (GRCm39) P81L probably damaging Het
Ginm1 A G 10: 7,650,980 (GRCm39) probably null Het
Glis3 T C 19: 28,508,985 (GRCm39) N333S probably damaging Het
Glo1 T G 17: 30,815,382 (GRCm39) E144D probably benign Het
Golga1 A T 2: 38,937,792 (GRCm39) probably null Het
H2-Aa A G 17: 34,502,207 (GRCm39) I155T possibly damaging Het
Haus5 A G 7: 30,356,670 (GRCm39) S479P probably damaging Het
Il10ra A T 9: 45,167,654 (GRCm39) V299D probably benign Het
Il17re T C 6: 113,446,665 (GRCm39) V472A probably damaging Het
Il22ra1 A T 4: 135,478,219 (GRCm39) Q430L probably damaging Het
Il23r A C 6: 67,400,718 (GRCm39) D537E probably benign Het
Inppl1 T C 7: 101,472,584 (GRCm39) E1237G possibly damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Klhl35 T C 7: 99,119,427 (GRCm39) L304P probably damaging Het
Krt78 A T 15: 101,855,398 (GRCm39) C804* probably null Het
Med15 G T 16: 17,491,018 (GRCm39) probably benign Het
Mettl25 A G 10: 105,661,948 (GRCm39) S341P probably damaging Het
Mroh1 A G 15: 76,320,249 (GRCm39) T1008A probably benign Het
Mug1 A G 6: 121,858,780 (GRCm39) D1166G probably benign Het
Mug2 C A 6: 122,048,801 (GRCm39) H856N probably benign Het
Naca T A 10: 127,879,590 (GRCm39) probably benign Het
Nagk G T 6: 83,776,336 (GRCm39) V184F probably damaging Het
Nav1 T G 1: 135,400,148 (GRCm39) N474T probably benign Het
Ncor2 T A 5: 125,102,489 (GRCm39) H2089L probably benign Het
Nek6 A G 2: 38,472,458 (GRCm39) I261V probably damaging Het
Neurod2 G A 11: 98,218,558 (GRCm39) T202M probably damaging Het
Nlgn2 A G 11: 69,716,726 (GRCm39) V605A probably damaging Het
Nlrp5 A C 7: 23,123,335 (GRCm39) E732A possibly damaging Het
Nt5dc1 A T 10: 34,189,667 (GRCm39) V340D probably damaging Het
Ntn4 A G 10: 93,543,234 (GRCm39) D320G possibly damaging Het
Or10al3 T A 17: 38,012,312 (GRCm39) H250Q probably damaging Het
Or10x1 A T 1: 174,196,734 (GRCm39) I84L probably benign Het
Or52l1 A G 7: 104,830,079 (GRCm39) I162T possibly damaging Het
Or52z15 T C 7: 103,332,750 (GRCm39) I265T probably damaging Het
Or5ac25 A T 16: 59,182,526 (GRCm39) D18E probably benign Het
Osbpl5 T C 7: 143,256,918 (GRCm39) D404G possibly damaging Het
Pcdhb12 T A 18: 37,570,683 (GRCm39) W610R possibly damaging Het
Pias2 T A 18: 77,185,139 (GRCm39) C66* probably null Het
Plec T A 15: 76,059,751 (GRCm39) E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Ppp1r12a T A 10: 108,034,752 (GRCm39) I99N probably damaging Het
Prpf8 T G 11: 75,395,570 (GRCm39) V1899G probably damaging Het
Prr13 C A 15: 102,369,133 (GRCm39) probably benign Het
Ptchd4 A T 17: 42,814,507 (GRCm39) I803L probably benign Het
R3hdm2 T C 10: 127,334,337 (GRCm39) I947T possibly damaging Het
Raet1d A G 10: 22,247,350 (GRCm39) D142G probably damaging Het
Rbbp8nl C T 2: 179,925,106 (GRCm39) R33Q probably damaging Het
Robo1 A G 16: 72,757,092 (GRCm39) Q351R probably null Het
Rptn A T 3: 93,304,017 (GRCm39) H450L possibly damaging Het
Scn11a T A 9: 119,608,102 (GRCm39) K1010* probably null Het
Slc16a10 G A 10: 39,932,602 (GRCm39) Q33* probably null Het
Slc31a1 C T 4: 62,303,842 (GRCm39) probably benign Het
Slc34a1 A T 13: 55,548,963 (GRCm39) K138* probably null Het
Slc6a18 T A 13: 73,818,162 (GRCm39) E285V probably benign Het
Slco6c1 T A 1: 97,000,707 (GRCm39) T515S probably damaging Het
Snx4 A T 16: 33,104,808 (GRCm39) Y252F possibly damaging Het
Spata18 T A 5: 73,828,482 (GRCm39) F348I probably damaging Het
Spef2 G T 15: 9,607,463 (GRCm39) R1319S probably damaging Het
Tas2r125 T C 6: 132,887,139 (GRCm39) F176L probably benign Het
Tcp10b A G 17: 13,300,513 (GRCm39) K399E possibly damaging Het
Tcstv3 A G 13: 120,779,260 (GRCm39) H53R probably damaging Het
Tnrc6c A G 11: 117,613,831 (GRCm39) K823R probably damaging Het
Trim31 A G 17: 37,212,692 (GRCm39) E221G probably benign Het
Trim47 T A 11: 115,998,605 (GRCm39) Q338L probably damaging Het
Tubgcp6 C A 15: 89,000,444 (GRCm39) R307L possibly damaging Het
Usp9y A G Y: 1,303,371 (GRCm39) probably null Het
Utp20 G T 10: 88,588,888 (GRCm39) T2427K probably benign Het
Vldlr T C 19: 27,218,709 (GRCm39) V147A probably damaging Het
Vmn1r115 C T 7: 20,578,198 (GRCm39) R238H probably benign Het
Vmn1r175 C A 7: 23,508,218 (GRCm39) R136S probably benign Het
Vmn1r53 A G 6: 90,201,268 (GRCm39) S19P possibly damaging Het
Vwa5b2 G T 16: 20,423,582 (GRCm39) S1165I possibly damaging Het
Zfp362 G T 4: 128,684,069 (GRCm39) P13T probably damaging Het
Zfp825 A G 13: 74,629,064 (GRCm39) C151R probably damaging Het
Other mutations in Snrnp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02200:Snrnp40 APN 4 130,254,014 (GRCm39) missense probably damaging 0.99
IGL02306:Snrnp40 APN 4 130,258,893 (GRCm39) missense probably benign 0.21
skywarp UTSW 4 130,271,836 (GRCm39) splice site probably null
R0027:Snrnp40 UTSW 4 130,262,066 (GRCm39) missense probably damaging 1.00
R0027:Snrnp40 UTSW 4 130,262,066 (GRCm39) missense probably damaging 1.00
R0077:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0134:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0211:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0349:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0371:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0372:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0376:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0377:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0400:Snrnp40 UTSW 4 130,256,443 (GRCm39) missense probably damaging 1.00
R0442:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0443:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0486:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0488:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0568:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0624:Snrnp40 UTSW 4 130,256,451 (GRCm39) missense probably damaging 0.98
R0632:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0650:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R0733:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1161:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1182:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1234:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1236:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1305:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1308:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1333:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1413:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1569:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1616:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1656:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1675:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1759:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1856:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1912:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1930:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R1931:Snrnp40 UTSW 4 130,271,836 (GRCm39) splice site probably null
R2435:Snrnp40 UTSW 4 130,278,344 (GRCm39) missense probably damaging 1.00
R3722:Snrnp40 UTSW 4 130,262,068 (GRCm39) missense possibly damaging 0.76
R4782:Snrnp40 UTSW 4 130,256,549 (GRCm39) missense probably damaging 1.00
R4799:Snrnp40 UTSW 4 130,256,549 (GRCm39) missense probably damaging 1.00
R5075:Snrnp40 UTSW 4 130,282,375 (GRCm39) missense probably benign 0.07
R5104:Snrnp40 UTSW 4 130,258,958 (GRCm39) missense possibly damaging 0.78
R5369:Snrnp40 UTSW 4 130,256,439 (GRCm39) missense probably damaging 0.97
R5699:Snrnp40 UTSW 4 130,258,958 (GRCm39) missense possibly damaging 0.78
R7529:Snrnp40 UTSW 4 130,278,275 (GRCm39) missense possibly damaging 0.94
R8264:Snrnp40 UTSW 4 130,271,867 (GRCm39) missense probably benign 0.00
R8412:Snrnp40 UTSW 4 130,278,316 (GRCm39) missense possibly damaging 0.49
R9319:Snrnp40 UTSW 4 130,256,545 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- CATCTCTACATCTAGTGTTTATGTGTT -3'
(R):5'- AACAGAGTCAATTCTCTAGGCCT -3'

Sequencing Primer
(F):5'- GTGGTGCCCAAACATACTTG -3'
(R):5'- GAGTCAATTCTCTAGGCCTAAAAAC -3'
Posted On 2014-06-30