Incidental Mutation 'R1901:Spata18'
ID212192
Institutional Source Beutler Lab
Gene Symbol Spata18
Ensembl Gene ENSMUSG00000029155
Gene Namespermatogenesis associated 18
Synonyms
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73651379-73679512 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73671139 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 348 (F348I)
Ref Sequence ENSEMBL: ENSMUSP00000064308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041422] [ENSMUST00000071077] [ENSMUST00000113548] [ENSMUST00000178631]
Predicted Effect probably damaging
Transcript: ENSMUST00000041422
AA Change: F316I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040922
Gene: ENSMUSG00000029155
AA Change: F316I

DomainStartEndE-ValueType
coiled coil region 178 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000071077
AA Change: F348I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064308
Gene: ENSMUSG00000029155
AA Change: F348I

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113548
AA Change: F58I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109176
Gene: ENSMUSG00000029155
AA Change: F58I

DomainStartEndE-ValueType
Pfam:MIEAP 6 195 2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178631
AA Change: F234I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137444
Gene: ENSMUSG00000029155
AA Change: F234I

DomainStartEndE-ValueType
coiled coil region 151 184 N/A INTRINSIC
coiled coil region 210 243 N/A INTRINSIC
Pfam:MIEAP 296 485 1.2e-65 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a p53-inducible protein that is able to induce lysosome-like organelles within mitochondria that eliminate oxidized mitochondrial proteins, thereby contributing to mitochondrial quality control. Dysregulation of mitochondrial quality control is associated with cancer and degenerative diseases. The encoded protein mediates accumulation of the lysosome-like mitochondrial organelles through interaction with B cell lymphoma 2 interacting protein 3 and B cell lymphoma 2 interacting protein 3 like at the outer mitochondrial membrane, which allows translocation of lysosomal proteins to the mitochondrial matrix from the cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homo- or heterozygous KO in mice also carrying one copy of the ApcMin allele leads to increased intestinal adenoma and adenocarcinoma tumor incidence and size. This double mutation and homozygous KO of the gene alone results in lower internal mitochondrial cristae density in small intestinal mucosal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acacb A T 5: 114,165,734 R73* probably null Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Aldh3b3 T C 19: 3,965,130 Y170H probably damaging Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
Golga1 A T 2: 39,047,780 probably null Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Olfr685 A G 7: 105,180,872 I162T possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Scn11a T A 9: 119,779,036 K1010* probably null Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Spata18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Spata18 APN 5 73657754 missense possibly damaging 0.80
IGL01331:Spata18 APN 5 73669681 missense probably damaging 1.00
IGL01394:Spata18 APN 5 73679345 splice site probably null
IGL01994:Spata18 APN 5 73657601 critical splice donor site probably null
IGL02192:Spata18 APN 5 73672518 splice site probably null
IGL02253:Spata18 APN 5 73668596 missense possibly damaging 0.61
IGL03195:Spata18 APN 5 73671248 missense probably damaging 1.00
IGL03204:Spata18 APN 5 73671106 splice site probably benign
ANU74:Spata18 UTSW 5 73671113 missense probably damaging 1.00
R0312:Spata18 UTSW 5 73666881 missense probably benign 0.00
R0557:Spata18 UTSW 5 73651670 missense probably damaging 1.00
R1624:Spata18 UTSW 5 73669545 missense probably damaging 0.98
R1937:Spata18 UTSW 5 73676964 missense probably damaging 1.00
R2228:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2229:Spata18 UTSW 5 73666901 missense possibly damaging 0.57
R2896:Spata18 UTSW 5 73657802 missense probably damaging 1.00
R3082:Spata18 UTSW 5 73679080 intron probably benign
R3716:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R3717:Spata18 UTSW 5 73666850 critical splice acceptor site probably null
R4061:Spata18 UTSW 5 73671166 missense probably damaging 1.00
R4299:Spata18 UTSW 5 73666902 missense probably benign 0.36
R4963:Spata18 UTSW 5 73678993 missense probably damaging 0.96
R5603:Spata18 UTSW 5 73671232 missense probably benign 0.12
R6381:Spata18 UTSW 5 73675216 missense probably damaging 1.00
R6581:Spata18 UTSW 5 73669516 missense probably benign 0.14
R7062:Spata18 UTSW 5 73659293 missense probably benign 0.08
R7591:Spata18 UTSW 5 73672416 missense
R7682:Spata18 UTSW 5 73668665 missense
R7688:Spata18 UTSW 5 73651662 missense probably benign 0.14
R7783:Spata18 UTSW 5 73668610 missense
R8051:Spata18 UTSW 5 73669720 missense
X0061:Spata18 UTSW 5 73666859 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGGCCGTCATATTACCTCAC -3'
(R):5'- AGATGGATGGATTCCTGAGTTATCG -3'

Sequencing Primer
(F):5'- CTCACAGGTCAAAGCTACGTTTG -3'
(R):5'- GTATGTCCTCATAAGTCACATGTCAC -3'
Posted On2014-06-30