Mutagenetix > Incidental Mutation

Incidental Mutation 'R1901:Acacb'

212194

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039921-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1901 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 114165734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 73 (R73*)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably null
Transcript: ENSMUST00000031583
AA Change: R73*

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: R73*

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102582
AA Change: R73*

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: R73*

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.2%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	G	7: 120,346,099	E466G	probably damaging	Het
Acta1	A	T	8: 123,893,161	S147T	probably benign	Het
Adh1	G	A	3: 138,288,797	V293I	probably benign	Het
Aldh3b3	T	C	19: 3,965,130	Y170H	probably damaging	Het
Ank3	A	T	10: 69,822,337	T198S	probably damaging	Het
Ankrd12	A	T	17: 65,986,703	N578K	possibly damaging	Het
Ano2	A	T	6: 125,872,684	E126D	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Cfap44	A	C	16: 44,422,374	T714P	probably benign	Het
Cnot1	T	C	8: 95,743,121	I1369V	possibly damaging	Het
Col19a1	A	T	1: 24,536,997	I88K	unknown	Het
Col1a1	G	A	11: 94,946,632		probably null	Het
Col5a1	A	G	2: 27,960,444	T518A	unknown	Het
Cul7	T	C	17: 46,655,740	L365P	probably damaging	Het
Dlec1	T	C	9: 119,102,644	S44P	probably damaging	Het
Dock9	T	C	14: 121,625,153		probably null	Het
Flrt2	C	A	12: 95,779,130	P81T	probably damaging	Het
Flrt2	C	T	12: 95,779,131	P81L	probably damaging	Het
Ginm1	A	G	10: 7,775,216		probably null	Het
Glis3	T	C	19: 28,531,585	N333S	probably damaging	Het
Glo1	T	G	17: 30,596,408	E144D	probably benign	Het
Golga1	A	T	2: 39,047,780		probably null	Het
H2-Aa	A	G	17: 34,283,233	I155T	possibly damaging	Het
Haus5	A	G	7: 30,657,245	S479P	probably damaging	Het
Il10ra	A	T	9: 45,256,356	V299D	probably benign	Het
Il17re	T	C	6: 113,469,704	V472A	probably damaging	Het
Il22ra1	A	T	4: 135,750,908	Q430L	probably damaging	Het
Il23r	A	C	6: 67,423,734	D537E	probably benign	Het
Inppl1	T	C	7: 101,823,377	E1237G	possibly damaging	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Klhl35	T	C	7: 99,470,220	L304P	probably damaging	Het
Krt78	A	T	15: 101,946,963	C804*	probably null	Het
Lrrc29	T	C	8: 105,313,075	N556S	probably damaging	Het
Med15	G	T	16: 17,673,154		probably benign	Het
Mettl25	A	G	10: 105,826,087	S341P	probably damaging	Het
Mroh1	A	G	15: 76,436,049	T1008A	probably benign	Het
Mug1	A	G	6: 121,881,821	D1166G	probably benign	Het
Mug2	C	A	6: 122,071,842	H856N	probably benign	Het
Naca	T	A	10: 128,043,721		probably benign	Het
Nagk	G	T	6: 83,799,354	V184F	probably damaging	Het
Nav1	T	G	1: 135,472,410	N474T	probably benign	Het
Ncor2	T	A	5: 125,025,425	H2089L	probably benign	Het
Nek6	A	G	2: 38,582,446	I261V	probably damaging	Het
Neurod2	G	A	11: 98,327,732	T202M	probably damaging	Het
Nlgn2	A	G	11: 69,825,900	V605A	probably damaging	Het
Nlrp5	A	C	7: 23,423,910	E732A	possibly damaging	Het
Nt5dc1	A	T	10: 34,313,671	V340D	probably damaging	Het
Ntn4	A	G	10: 93,707,372	D320G	possibly damaging	Het
Olfr119	T	A	17: 37,701,421	H250Q	probably damaging	Het
Olfr209	A	T	16: 59,362,163	D18E	probably benign	Het
Olfr417	A	T	1: 174,369,168	I84L	probably benign	Het
Olfr625-ps1	T	C	7: 103,683,543	I265T	probably damaging	Het
Olfr685	A	G	7: 105,180,872	I162T	possibly damaging	Het
Osbpl5	T	C	7: 143,703,181	D404G	possibly damaging	Het
Pcdhb12	T	A	18: 37,437,630	W610R	possibly damaging	Het
Pias2	T	A	18: 77,097,443	C66*	probably null	Het
Plec	T	A	15: 76,175,551	E3417D	probably damaging	Het
Plekhm3	CCTGCTGCTGCTGCTGCTGCTGCTGC	CCTGCTGCTGCTGCTGCTGCTGC	1: 64,937,781		probably benign	Het
Ppp1r12a	T	A	10: 108,198,891	I99N	probably damaging	Het
Prpf8	T	G	11: 75,504,744	V1899G	probably damaging	Het
Prr13	C	A	15: 102,460,698		probably benign	Het
Ptchd4	A	T	17: 42,503,616	I803L	probably benign	Het
R3hdm2	T	C	10: 127,498,468	I947T	possibly damaging	Het
Raet1d	A	G	10: 22,371,451	D142G	probably damaging	Het
Rbbp8nl	C	T	2: 180,283,313	R33Q	probably damaging	Het
Robo1	A	G	16: 72,960,204	Q351R	probably null	Het
Rptn	A	T	3: 93,396,710	H450L	possibly damaging	Het
Scn11a	T	A	9: 119,779,036	K1010*	probably null	Het
Slc16a10	G	A	10: 40,056,606	Q33*	probably null	Het
Slc31a1	C	T	4: 62,385,605		probably benign	Het
Slc34a1	A	T	13: 55,401,150	K138*	probably null	Het
Slc6a18	T	A	13: 73,670,043	E285V	probably benign	Het
Slco6c1	T	A	1: 97,072,982	T515S	probably damaging	Het
Snrnp40	T	A	4: 130,385,975	S295T	probably damaging	Het
Snx4	A	T	16: 33,284,438	Y252F	possibly damaging	Het
Spata18	T	A	5: 73,671,139	F348I	probably damaging	Het
Spef2	G	T	15: 9,607,377	R1319S	probably damaging	Het
Tas2r125	T	C	6: 132,910,176	F176L	probably benign	Het
Tcp10b	A	G	17: 13,081,626	K399E	possibly damaging	Het
Tcstv3	A	G	13: 120,317,724	H53R	probably damaging	Het
Tnrc6c	A	G	11: 117,723,005	K823R	probably damaging	Het
Trim31	A	G	17: 36,901,800	E221G	probably benign	Het
Trim47	T	A	11: 116,107,779	Q338L	probably damaging	Het
Tubgcp6	C	A	15: 89,116,241	R307L	possibly damaging	Het
Usp9y	A	G	Y: 1,303,371		probably null	Het
Utp20	G	T	10: 88,753,026	T2427K	probably benign	Het
Vldlr	T	C	19: 27,241,309	V147A	probably damaging	Het
Vmn1r115	C	T	7: 20,844,273	R238H	probably benign	Het
Vmn1r175	C	A	7: 23,808,793	R136S	probably benign	Het
Vmn1r53	A	G	6: 90,224,286	S19P	possibly damaging	Het
Vwa5b2	G	T	16: 20,604,832	S1165I	possibly damaging	Het
Zfp362	G	T	4: 128,790,276	P13T	probably damaging	Het
Zfp825	A	G	13: 74,480,945	C151R	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGCCTGAATGGTCTTGCTTC -3'
(R):5'- AGCCCAGGATAAAGCTGGTC -3'

Sequencing Primer
(F):5'- GAATGGTCTTGCTTCTCTTTCTGAC -3'
(R):5'- CCCAGGATAAAGCTGGTCATCAG -3'

Posted On

2014-06-30