Incidental Mutation 'R1901:Acacb'
ID212194
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 114165734 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 73 (R73*)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably null
Transcript: ENSMUST00000031583
AA Change: R73*
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: R73*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102582
AA Change: R73*
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: R73*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Aldh3b3 T C 19: 3,965,130 Y170H probably damaging Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
Golga1 A T 2: 39,047,780 probably null Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Olfr685 A G 7: 105,180,872 I162T possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Scn11a T A 9: 119,779,036 K1010* probably null Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spata18 T A 5: 73,671,139 F348I probably damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
acetone UTSW 5 114226857 nonsense probably null
anabolism UTSW 5 114245220 missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7396:Acacb UTSW 5 114213661 missense possibly damaging 0.87
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
R8678:Acacb UTSW 5 114201971 nonsense probably null
R8693:Acacb UTSW 5 114226783 missense probably damaging 0.99
R8697:Acacb UTSW 5 114213380 missense probably damaging 0.96
R8772:Acacb UTSW 5 114184118 missense possibly damaging 0.73
R8918:Acacb UTSW 5 114195254 missense probably damaging 1.00
R9044:Acacb UTSW 5 114235517 missense probably benign 0.00
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCTGAATGGTCTTGCTTC -3'
(R):5'- AGCCCAGGATAAAGCTGGTC -3'

Sequencing Primer
(F):5'- GAATGGTCTTGCTTCTCTTTCTGAC -3'
(R):5'- CCCAGGATAAAGCTGGTCATCAG -3'
Posted On2014-06-30