Mutagenetix > Incidental Mutation

Incidental Mutation 'R0124:C2cd3'

21220

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

038409-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0124 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100469518 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2321 (E2321G)

Ref Sequence

ENSEMBL: ENSMUSP00000062637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000107059] [ENSMUST00000120196]

AlphaFold

Q52KB6

Predicted Effect

probably benign
Transcript: ENSMUST00000032958

SMART Domains

Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	3.1e-20	PFAM
Pfam:Mito_carr	109	207	9.6e-26	PFAM
Pfam:Mito_carr	210	301	2.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000051777
AA Change: E2321G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: E2321G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098259

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107059

SMART Domains

Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	9	107	5.9e-22	PFAM
Pfam:Mito_carr	109	207	1.7e-27	PFAM
Pfam:Mito_carr	209	301	9.4e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120196

SMART Domains

Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	297	308	N/A	INTRINSIC
C2	415	553	1.5e-1	SMART
C2	681	790	2.4e-2	SMART
C2	880	1020	9.5e-2	SMART
C2	1073	1212	1.1e-1	SMART
C2	1508	1615	9e-5	SMART
low complexity region	1783	1797	N/A	INTRINSIC
low complexity region	1928	1940	N/A	INTRINSIC
low complexity region	2001	2016	N/A	INTRINSIC
low complexity region	2071	2087	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184420

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208018

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.3%
10x: 95.7%
20x: 89.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,161,674	T194A	probably benign	Het
Afap1	C	T	5: 35,945,209	P82S	probably damaging	Het
Ankrd28	A	G	14: 31,727,741	Y481H	probably damaging	Het
Arid1b	C	T	17: 5,339,330	T1717I	probably damaging	Het
Atad2b	A	G	12: 4,952,676	K348R	probably benign	Het
B020004J07Rik	A	G	4: 101,835,373	*477Q	probably null	Het
Bcl3	C	T	7: 19,809,651	V5M	probably damaging	Het
Casq1	C	T	1: 172,210,425	V380M	probably damaging	Het
Cd209e	T	A	8: 3,851,274	T127S	probably benign	Het
Cdh23	G	T	10: 60,308,056	Y2921*	probably null	Het
Cdh6	A	G	15: 13,034,324	L750P	probably damaging	Het
Cdk12	T	C	11: 98,211,247		probably benign	Het
Ces5a	T	C	8: 93,528,555	E170G	probably damaging	Het
Clec4f	A	G	6: 83,652,353		probably null	Het
Col19a1	T	C	1: 24,526,458	N264S	unknown	Het
Col2a1	T	A	15: 97,998,862	I43F	unknown	Het
Col4a2	A	G	8: 11,408,871		probably benign	Het
Csmd3	T	A	15: 47,590,716	D3578V	probably damaging	Het
Cyp2c37	T	C	19: 39,994,102	L128P	probably damaging	Het
Dysf	A	G	6: 84,065,102		probably benign	Het
Eml1	T	C	12: 108,506,608	V225A	probably benign	Het
Eml1	A	G	12: 108,509,178	Y256C	probably damaging	Het
Epb41l5	T	A	1: 119,633,640	K64*	probably null	Het
Fat2	A	G	11: 55,283,678	F2070L	probably damaging	Het
Fbxw18	G	T	9: 109,691,515	H259N	probably benign	Het
Gm10764	A	T	10: 87,290,748	T6S	unknown	Het
Gm14412	A	G	2: 177,315,912		probably benign	Het
Heatr5b	A	T	17: 78,826,217		probably benign	Het
Hid1	T	C	11: 115,356,823	T250A	probably damaging	Het
Hnf4g	A	G	3: 3,643,082		probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Lrriq1	C	T	10: 103,170,420		probably null	Het
Map3k13	A	G	16: 21,903,756	T223A	possibly damaging	Het
Matn2	C	T	15: 34,426,151		probably benign	Het
Myo6	A	G	9: 80,307,774	E1253G	probably damaging	Het
Nomo1	G	T	7: 46,083,228		probably benign	Het
Olfr1221	A	T	2: 89,111,744	I256K	possibly damaging	Het
Olfr160	A	G	9: 37,711,463	V272A	possibly damaging	Het
Olfr356	A	T	2: 36,937,256	I46F	possibly damaging	Het
Papolg	C	T	11: 23,867,535	A582T	probably benign	Het
Plekhm3	C	T	1: 64,921,751	E449K	probably damaging	Het
Pole	T	G	5: 110,303,992	M900R	probably damaging	Het
Ppp1cb	T	A	5: 32,483,478		probably benign	Het
Pros1	A	G	16: 62,913,946	T372A	possibly damaging	Het
Scara3	A	T	14: 65,931,221	S316T	probably benign	Het
St5	A	G	7: 109,542,511	S132P	possibly damaging	Het
Stau2	C	T	1: 16,463,128	A61T	probably damaging	Het
Stx3	T	C	19: 11,791,799	E54G	possibly damaging	Het
Sun1	T	C	5: 139,246,679		probably benign	Het
Swt1	A	T	1: 151,391,529	C634S	probably damaging	Het
Syt6	A	G	3: 103,587,526	Y269C	probably damaging	Het
Tfap2a	G	A	13: 40,717,411		probably benign	Het
Tmx4	A	T	2: 134,639,720		probably null	Het
Ttc39d	T	C	17: 80,216,946	C345R	probably damaging	Het
Vmn1r27	T	C	6: 58,215,248	Y257C	probably damaging	Het
Vmn2r27	T	A	6: 124,231,619	T56S	probably benign	Het
Vps13b	T	C	15: 35,576,528		probably null	Het
Wdr17	A	G	8: 54,635,491	S1175P	probably damaging	Het
Wsb2	T	C	5: 117,363,758	F63L	probably benign	Het
Zfp142	A	G	1: 74,568,623	Y1561H	probably damaging	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6631:C2cd3	UTSW	7	100418540	missense	probably damaging	1.00
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
R8753:C2cd3	UTSW	7	100399817	critical splice donor site	probably null
R8893:C2cd3	UTSW	7	100454797	missense	probably benign
R8905:C2cd3	UTSW	7	100424925	critical splice donor site	probably null
R8945:C2cd3	UTSW	7	100391079	missense	possibly damaging	0.88
R8970:C2cd3	UTSW	7	100419764	missense
R9000:C2cd3	UTSW	7	100416074	missense
R9064:C2cd3	UTSW	7	100410401	missense
R9072:C2cd3	UTSW	7	100391084	missense	probably benign	0.07
R9126:C2cd3	UTSW	7	100432223	missense
R9160:C2cd3	UTSW	7	100426029	missense
R9234:C2cd3	UTSW	7	100399805	missense
R9258:C2cd3	UTSW	7	100448819	missense
R9295:C2cd3	UTSW	7	100432527	missense
R9411:C2cd3	UTSW	7	100416497	missense
R9420:C2cd3	UTSW	7	100416055	missense
R9589:C2cd3	UTSW	7	100432549	missense
R9628:C2cd3	UTSW	7	100448754	missense
R9629:C2cd3	UTSW	7	100380042	missense	probably damaging	1.00
R9681:C2cd3	UTSW	7	100374455	missense	probably benign	0.32
R9775:C2cd3	UTSW	7	100427251	missense
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CACCTCTGCAATGCTGTATCCTCAG -3'
(R):5'- TGAGTCTCACTTCCAGCAGTCACC -3'

Sequencing Primer
(F):5'- CAATGCTGTATCCTCAGGACTAATC -3'
(R):5'- TCACCTCATTACAGAAGGAAGCTG -3'

Posted On

2013-04-11