Incidental Mutation 'R0124:Dennd2b'
ID 21221
Institutional Source Beutler Lab
Gene Symbol Dennd2b
Ensembl Gene ENSMUSG00000031024
Gene Name DENN domain containing 2B
Synonyms Denn2b, 2610305K15Rik, St5, 2010004M01Rik
MMRRC Submission 038409-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.390) question?
Stock # R0124 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 109123118-109302812 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 109141718 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 132 (S132P)
Ref Sequence ENSEMBL: ENSMUSP00000130119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect possibly damaging
Transcript: ENSMUST00000077909
AA Change: S549P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: S549P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079282
AA Change: S549P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: S549P

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084738
AA Change: S132P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168005
AA Change: S132P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: S132P

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208557
Meta Mutation Damage Score 0.1182 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,138,656 (GRCm39) T194A probably benign Het
Afap1 C T 5: 36,102,553 (GRCm39) P82S probably damaging Het
Ankrd28 A G 14: 31,449,698 (GRCm39) Y481H probably damaging Het
Arid1b C T 17: 5,389,605 (GRCm39) T1717I probably damaging Het
Atad2b A G 12: 5,002,676 (GRCm39) K348R probably benign Het
Bcl3 C T 7: 19,543,576 (GRCm39) V5M probably damaging Het
C2cd3 A G 7: 100,118,725 (GRCm39) E2321G probably benign Het
Casq1 C T 1: 172,037,992 (GRCm39) V380M probably damaging Het
Cd209e T A 8: 3,901,274 (GRCm39) T127S probably benign Het
Cdh23 G T 10: 60,143,835 (GRCm39) Y2921* probably null Het
Cdh6 A G 15: 13,034,410 (GRCm39) L750P probably damaging Het
Cdk12 T C 11: 98,102,073 (GRCm39) probably benign Het
Ces5a T C 8: 94,255,183 (GRCm39) E170G probably damaging Het
Clec4f A G 6: 83,629,335 (GRCm39) probably null Het
Col19a1 T C 1: 24,565,539 (GRCm39) N264S unknown Het
Col2a1 T A 15: 97,896,743 (GRCm39) I43F unknown Het
Col4a2 A G 8: 11,458,871 (GRCm39) probably benign Het
Csmd3 T A 15: 47,454,112 (GRCm39) D3578V probably damaging Het
Cyp2c37 T C 19: 39,982,546 (GRCm39) L128P probably damaging Het
Dysf A G 6: 84,042,084 (GRCm39) probably benign Het
Eml1 T C 12: 108,472,867 (GRCm39) V225A probably benign Het
Eml1 A G 12: 108,475,437 (GRCm39) Y256C probably damaging Het
Epb41l5 T A 1: 119,561,370 (GRCm39) K64* probably null Het
Fat2 A G 11: 55,174,504 (GRCm39) F2070L probably damaging Het
Fbxw18 G T 9: 109,520,583 (GRCm39) H259N probably benign Het
Gm10764 A T 10: 87,126,610 (GRCm39) T6S unknown Het
Gm14412 A G 2: 177,007,705 (GRCm39) probably benign Het
Heatr5b A T 17: 79,133,646 (GRCm39) probably benign Het
Hid1 T C 11: 115,247,649 (GRCm39) T250A probably damaging Het
Hnf4g A G 3: 3,708,142 (GRCm39) probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Lrriq1 C T 10: 103,006,281 (GRCm39) probably null Het
Map3k13 A G 16: 21,722,506 (GRCm39) T223A possibly damaging Het
Matn2 C T 15: 34,426,297 (GRCm39) probably benign Het
Myo6 A G 9: 80,215,056 (GRCm39) E1253G probably damaging Het
Nomo1 G T 7: 45,732,652 (GRCm39) probably benign Het
Or1ak2 A T 2: 36,827,268 (GRCm39) I46F possibly damaging Het
Or4c116 A T 2: 88,942,088 (GRCm39) I256K possibly damaging Het
Or8a1b A G 9: 37,622,759 (GRCm39) V272A possibly damaging Het
Papolg C T 11: 23,817,535 (GRCm39) A582T probably benign Het
Plekhm3 C T 1: 64,960,910 (GRCm39) E449K probably damaging Het
Pole T G 5: 110,451,858 (GRCm39) M900R probably damaging Het
Ppp1cb T A 5: 32,640,822 (GRCm39) probably benign Het
Pramel17 A G 4: 101,692,570 (GRCm39) *477Q probably null Het
Pros1 A G 16: 62,734,309 (GRCm39) T372A possibly damaging Het
Scara3 A T 14: 66,168,670 (GRCm39) S316T probably benign Het
Stau2 C T 1: 16,533,352 (GRCm39) A61T probably damaging Het
Stx3 T C 19: 11,769,163 (GRCm39) E54G possibly damaging Het
Sun1 T C 5: 139,232,434 (GRCm39) probably benign Het
Swt1 A T 1: 151,267,280 (GRCm39) C634S probably damaging Het
Syt6 A G 3: 103,494,842 (GRCm39) Y269C probably damaging Het
Tfap2a G A 13: 40,870,887 (GRCm39) probably benign Het
Tmx4 A T 2: 134,481,640 (GRCm39) probably null Het
Ttc39d T C 17: 80,524,375 (GRCm39) C345R probably damaging Het
Vmn1r27 T C 6: 58,192,233 (GRCm39) Y257C probably damaging Het
Vmn2r27 T A 6: 124,208,578 (GRCm39) T56S probably benign Het
Vps13b T C 15: 35,576,674 (GRCm39) probably null Het
Wdr17 A G 8: 55,088,526 (GRCm39) S1175P probably damaging Het
Wsb2 T C 5: 117,501,823 (GRCm39) F63L probably benign Het
Zfp142 A G 1: 74,607,782 (GRCm39) Y1561H probably damaging Het
Other mutations in Dennd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dennd2b APN 7 109,126,915 (GRCm39) missense possibly damaging 0.71
IGL01132:Dennd2b APN 7 109,169,212 (GRCm39) splice site probably null
IGL01288:Dennd2b APN 7 109,139,029 (GRCm39) missense probably damaging 0.96
IGL01645:Dennd2b APN 7 109,126,841 (GRCm39) nonsense probably null
IGL01714:Dennd2b APN 7 109,169,269 (GRCm39) missense probably damaging 0.99
IGL02021:Dennd2b APN 7 109,156,579 (GRCm39) missense probably damaging 1.00
IGL02302:Dennd2b APN 7 109,124,538 (GRCm39) missense probably damaging 1.00
IGL02496:Dennd2b APN 7 109,155,442 (GRCm39) missense possibly damaging 0.83
IGL02795:Dennd2b APN 7 109,155,571 (GRCm39) missense probably damaging 1.00
Bucolic UTSW 7 109,124,755 (GRCm39) nonsense probably null
Halcyon UTSW 7 109,156,000 (GRCm39) nonsense probably null
FR4340:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
FR4737:Dennd2b UTSW 7 109,156,128 (GRCm39) unclassified probably benign
PIT4466001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4469001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
PIT4472001:Dennd2b UTSW 7 109,130,337 (GRCm39) missense probably damaging 1.00
R0024:Dennd2b UTSW 7 109,123,866 (GRCm39) missense probably damaging 1.00
R0125:Dennd2b UTSW 7 109,155,545 (GRCm39) missense probably benign 0.19
R0365:Dennd2b UTSW 7 109,138,156 (GRCm39) missense probably damaging 1.00
R0491:Dennd2b UTSW 7 109,156,411 (GRCm39) missense probably benign 0.45
R0534:Dennd2b UTSW 7 109,140,635 (GRCm39) missense probably damaging 1.00
R0662:Dennd2b UTSW 7 109,156,633 (GRCm39) missense probably damaging 1.00
R0743:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R0772:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0774:Dennd2b UTSW 7 109,141,527 (GRCm39) splice site probably null
R0787:Dennd2b UTSW 7 109,124,827 (GRCm39) missense possibly damaging 0.94
R0884:Dennd2b UTSW 7 109,156,552 (GRCm39) missense probably damaging 1.00
R1518:Dennd2b UTSW 7 109,156,562 (GRCm39) missense probably damaging 1.00
R1908:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R1909:Dennd2b UTSW 7 109,124,533 (GRCm39) nonsense probably null
R2232:Dennd2b UTSW 7 109,156,414 (GRCm39) missense probably benign
R2358:Dennd2b UTSW 7 109,155,653 (GRCm39) missense probably benign 0.01
R2847:Dennd2b UTSW 7 109,124,544 (GRCm39) missense probably damaging 1.00
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2869:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2870:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2871:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2873:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R2874:Dennd2b UTSW 7 109,156,637 (GRCm39) missense probably benign 0.01
R4534:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4536:Dennd2b UTSW 7 109,130,363 (GRCm39) missense probably damaging 1.00
R4559:Dennd2b UTSW 7 109,124,785 (GRCm39) missense probably damaging 1.00
R4798:Dennd2b UTSW 7 109,156,240 (GRCm39) missense probably damaging 0.99
R4846:Dennd2b UTSW 7 109,156,043 (GRCm39) nonsense probably null
R5110:Dennd2b UTSW 7 109,141,697 (GRCm39) missense probably benign 0.02
R5181:Dennd2b UTSW 7 109,155,997 (GRCm39) missense probably benign
R5268:Dennd2b UTSW 7 109,156,519 (GRCm39) missense probably benign
R5403:Dennd2b UTSW 7 109,156,112 (GRCm39) missense probably damaging 1.00
R5836:Dennd2b UTSW 7 109,140,552 (GRCm39) missense possibly damaging 0.78
R5932:Dennd2b UTSW 7 109,169,223 (GRCm39) missense probably damaging 1.00
R5937:Dennd2b UTSW 7 109,156,478 (GRCm39) missense possibly damaging 0.86
R6180:Dennd2b UTSW 7 109,156,095 (GRCm39) missense probably benign 0.11
R6741:Dennd2b UTSW 7 109,144,304 (GRCm39) missense possibly damaging 0.95
R6781:Dennd2b UTSW 7 109,124,511 (GRCm39) missense possibly damaging 0.83
R7086:Dennd2b UTSW 7 109,124,781 (GRCm39) missense probably damaging 1.00
R7466:Dennd2b UTSW 7 109,124,553 (GRCm39) missense probably damaging 1.00
R7644:Dennd2b UTSW 7 109,156,000 (GRCm39) nonsense probably null
R8354:Dennd2b UTSW 7 109,124,755 (GRCm39) nonsense probably null
R8745:Dennd2b UTSW 7 109,156,279 (GRCm39) missense probably benign 0.02
R8859:Dennd2b UTSW 7 109,123,863 (GRCm39) missense probably damaging 1.00
R9016:Dennd2b UTSW 7 109,139,642 (GRCm39) missense possibly damaging 0.84
R9178:Dennd2b UTSW 7 109,156,291 (GRCm39) missense probably benign 0.31
R9361:Dennd2b UTSW 7 109,126,991 (GRCm39) missense probably damaging 1.00
R9564:Dennd2b UTSW 7 109,125,536 (GRCm39) missense probably damaging 1.00
R9595:Dennd2b UTSW 7 109,155,973 (GRCm39) missense probably damaging 0.96
RF062:Dennd2b UTSW 7 109,156,153 (GRCm39) unclassified probably benign
X0067:Dennd2b UTSW 7 109,155,447 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCAATGCGGGAAGGATACCTTGG -3'
(R):5'- CCTCTGTCAAAGTTCAGACAGTGCC -3'

Sequencing Primer
(F):5'- ATACCTTGGGAATGCGGC -3'
(R):5'- CTGGCAGAAGAAGTAACACTTTC -3'
Posted On 2013-04-11