Mutagenetix > Incidental Mutations

Incidental Mutation 'R0124:St5'

21221

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

038409-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.551) question?

Stock #

R0124 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109542511 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 132 (S132P)

Ref Sequence

ENSEMBL: ENSMUSP00000130119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077909
AA Change: S549P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: S549P

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079282
AA Change: S549P

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: S549P

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084738
AA Change: S132P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: S132P

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168005
AA Change: S132P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: S132P

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Meta Mutation Damage Score

0.1182

Coding Region Coverage

1x: 99.3%
3x: 98.3%
10x: 95.7%
20x: 89.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,161,674	T194A	probably benign	Het
Afap1	C	T	5: 35,945,209	P82S	probably damaging	Het
Ankrd28	A	G	14: 31,727,741	Y481H	probably damaging	Het
Arid1b	C	T	17: 5,339,330	T1717I	probably damaging	Het
Atad2b	A	G	12: 4,952,676	K348R	probably benign	Het
B020004J07Rik	A	G	4: 101,835,373	*477Q	probably null	Het
Bcl3	C	T	7: 19,809,651	V5M	probably damaging	Het
C2cd3	A	G	7: 100,469,518	E2321G	probably benign	Het
Casq1	C	T	1: 172,210,425	V380M	probably damaging	Het
Cd209e	T	A	8: 3,851,274	T127S	probably benign	Het
Cdh23	G	T	10: 60,308,056	Y2921*	probably null	Het
Cdh6	A	G	15: 13,034,324	L750P	probably damaging	Het
Cdk12	T	C	11: 98,211,247		probably benign	Het
Ces5a	T	C	8: 93,528,555	E170G	probably damaging	Het
Clec4f	A	G	6: 83,652,353		probably null	Het
Col19a1	T	C	1: 24,526,458	N264S	unknown	Het
Col2a1	T	A	15: 97,998,862	I43F	unknown	Het
Col4a2	A	G	8: 11,408,871		probably benign	Het
Csmd3	T	A	15: 47,590,716	D3578V	probably damaging	Het
Cyp2c37	T	C	19: 39,994,102	L128P	probably damaging	Het
Dysf	A	G	6: 84,065,102		probably benign	Het
Eml1	T	C	12: 108,506,608	V225A	probably benign	Het
Eml1	A	G	12: 108,509,178	Y256C	probably damaging	Het
Epb41l5	T	A	1: 119,633,640	K64*	probably null	Het
Fat2	A	G	11: 55,283,678	F2070L	probably damaging	Het
Fbxw18	G	T	9: 109,691,515	H259N	probably benign	Het
Gm10764	A	T	10: 87,290,748	T6S	unknown	Het
Gm14412	A	G	2: 177,315,912		probably benign	Het
Heatr5b	A	T	17: 78,826,217		probably benign	Het
Hid1	T	C	11: 115,356,823	T250A	probably damaging	Het
Hnf4g	A	G	3: 3,643,082		probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Lrriq1	C	T	10: 103,170,420		probably null	Het
Map3k13	A	G	16: 21,903,756	T223A	possibly damaging	Het
Matn2	C	T	15: 34,426,151		probably benign	Het
Myo6	A	G	9: 80,307,774	E1253G	probably damaging	Het
Nomo1	G	T	7: 46,083,228		probably benign	Het
Olfr1221	A	T	2: 89,111,744	I256K	possibly damaging	Het
Olfr160	A	G	9: 37,711,463	V272A	possibly damaging	Het
Olfr356	A	T	2: 36,937,256	I46F	possibly damaging	Het
Papolg	C	T	11: 23,867,535	A582T	probably benign	Het
Plekhm3	C	T	1: 64,921,751	E449K	probably damaging	Het
Pole	T	G	5: 110,303,992	M900R	probably damaging	Het
Ppp1cb	T	A	5: 32,483,478		probably benign	Het
Pros1	A	G	16: 62,913,946	T372A	possibly damaging	Het
Scara3	A	T	14: 65,931,221	S316T	probably benign	Het
Stau2	C	T	1: 16,463,128	A61T	probably damaging	Het
Stx3	T	C	19: 11,791,799	E54G	possibly damaging	Het
Sun1	T	C	5: 139,246,679		probably benign	Het
Swt1	A	T	1: 151,391,529	C634S	probably damaging	Het
Syt6	A	G	3: 103,587,526	Y269C	probably damaging	Het
Tfap2a	G	A	13: 40,717,411		probably benign	Het
Tmx4	A	T	2: 134,639,720		probably null	Het
Ttc39d	T	C	17: 80,216,946	C345R	probably damaging	Het
Vmn1r27	T	C	6: 58,215,248	Y257C	probably damaging	Het
Vmn2r27	T	A	6: 124,231,619	T56S	probably benign	Het
Vps13b	T	C	15: 35,576,528		probably null	Het
Wdr17	A	G	8: 54,635,491	S1175P	probably damaging	Het
Wsb2	T	C	5: 117,363,758	F63L	probably benign	Het
Zfp142	A	G	1: 74,568,623	Y1561H	probably damaging	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0365:St5	UTSW	7	109538949	missense	probably damaging	1.00
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTCAATGCGGGAAGGATACCTTGG -3'
(R):5'- CCTCTGTCAAAGTTCAGACAGTGCC -3'

Sequencing Primer
(F):5'- ATACCTTGGGAATGCGGC -3'
(R):5'- CTGGCAGAAGAAGTAACACTTTC -3'

Posted On

2013-04-11