Incidental Mutation 'R0124:Cd209e'
ID 21222
Institutional Source Beutler Lab
Gene Symbol Cd209e
Ensembl Gene ENSMUSG00000040197
Gene Name CD209e antigen
Synonyms SIGNR4, mSIGNR4
MMRRC Submission 038409-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R0124 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 8
Chromosomal Location 3897973-3904286 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3901274 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 127 (T127S)
Ref Sequence ENSEMBL: ENSMUSP00000033888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033888]
AlphaFold Q91ZW7
Predicted Effect probably benign
Transcript: ENSMUST00000033888
AA Change: T127S

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: T127S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 77 198 4.01e-33 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,138,656 (GRCm39) T194A probably benign Het
Afap1 C T 5: 36,102,553 (GRCm39) P82S probably damaging Het
Ankrd28 A G 14: 31,449,698 (GRCm39) Y481H probably damaging Het
Arid1b C T 17: 5,389,605 (GRCm39) T1717I probably damaging Het
Atad2b A G 12: 5,002,676 (GRCm39) K348R probably benign Het
Bcl3 C T 7: 19,543,576 (GRCm39) V5M probably damaging Het
C2cd3 A G 7: 100,118,725 (GRCm39) E2321G probably benign Het
Casq1 C T 1: 172,037,992 (GRCm39) V380M probably damaging Het
Cdh23 G T 10: 60,143,835 (GRCm39) Y2921* probably null Het
Cdh6 A G 15: 13,034,410 (GRCm39) L750P probably damaging Het
Cdk12 T C 11: 98,102,073 (GRCm39) probably benign Het
Ces5a T C 8: 94,255,183 (GRCm39) E170G probably damaging Het
Clec4f A G 6: 83,629,335 (GRCm39) probably null Het
Col19a1 T C 1: 24,565,539 (GRCm39) N264S unknown Het
Col2a1 T A 15: 97,896,743 (GRCm39) I43F unknown Het
Col4a2 A G 8: 11,458,871 (GRCm39) probably benign Het
Csmd3 T A 15: 47,454,112 (GRCm39) D3578V probably damaging Het
Cyp2c37 T C 19: 39,982,546 (GRCm39) L128P probably damaging Het
Dennd2b A G 7: 109,141,718 (GRCm39) S132P possibly damaging Het
Dysf A G 6: 84,042,084 (GRCm39) probably benign Het
Eml1 T C 12: 108,472,867 (GRCm39) V225A probably benign Het
Eml1 A G 12: 108,475,437 (GRCm39) Y256C probably damaging Het
Epb41l5 T A 1: 119,561,370 (GRCm39) K64* probably null Het
Fat2 A G 11: 55,174,504 (GRCm39) F2070L probably damaging Het
Fbxw18 G T 9: 109,520,583 (GRCm39) H259N probably benign Het
Gm10764 A T 10: 87,126,610 (GRCm39) T6S unknown Het
Gm14412 A G 2: 177,007,705 (GRCm39) probably benign Het
Heatr5b A T 17: 79,133,646 (GRCm39) probably benign Het
Hid1 T C 11: 115,247,649 (GRCm39) T250A probably damaging Het
Hnf4g A G 3: 3,708,142 (GRCm39) probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Lrriq1 C T 10: 103,006,281 (GRCm39) probably null Het
Map3k13 A G 16: 21,722,506 (GRCm39) T223A possibly damaging Het
Matn2 C T 15: 34,426,297 (GRCm39) probably benign Het
Myo6 A G 9: 80,215,056 (GRCm39) E1253G probably damaging Het
Nomo1 G T 7: 45,732,652 (GRCm39) probably benign Het
Or1ak2 A T 2: 36,827,268 (GRCm39) I46F possibly damaging Het
Or4c116 A T 2: 88,942,088 (GRCm39) I256K possibly damaging Het
Or8a1b A G 9: 37,622,759 (GRCm39) V272A possibly damaging Het
Papolg C T 11: 23,817,535 (GRCm39) A582T probably benign Het
Plekhm3 C T 1: 64,960,910 (GRCm39) E449K probably damaging Het
Pole T G 5: 110,451,858 (GRCm39) M900R probably damaging Het
Ppp1cb T A 5: 32,640,822 (GRCm39) probably benign Het
Pramel17 A G 4: 101,692,570 (GRCm39) *477Q probably null Het
Pros1 A G 16: 62,734,309 (GRCm39) T372A possibly damaging Het
Scara3 A T 14: 66,168,670 (GRCm39) S316T probably benign Het
Stau2 C T 1: 16,533,352 (GRCm39) A61T probably damaging Het
Stx3 T C 19: 11,769,163 (GRCm39) E54G possibly damaging Het
Sun1 T C 5: 139,232,434 (GRCm39) probably benign Het
Swt1 A T 1: 151,267,280 (GRCm39) C634S probably damaging Het
Syt6 A G 3: 103,494,842 (GRCm39) Y269C probably damaging Het
Tfap2a G A 13: 40,870,887 (GRCm39) probably benign Het
Tmx4 A T 2: 134,481,640 (GRCm39) probably null Het
Ttc39d T C 17: 80,524,375 (GRCm39) C345R probably damaging Het
Vmn1r27 T C 6: 58,192,233 (GRCm39) Y257C probably damaging Het
Vmn2r27 T A 6: 124,208,578 (GRCm39) T56S probably benign Het
Vps13b T C 15: 35,576,674 (GRCm39) probably null Het
Wdr17 A G 8: 55,088,526 (GRCm39) S1175P probably damaging Het
Wsb2 T C 5: 117,501,823 (GRCm39) F63L probably benign Het
Zfp142 A G 1: 74,607,782 (GRCm39) Y1561H probably damaging Het
Other mutations in Cd209e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cd209e APN 8 3,902,800 (GRCm39) missense probably benign 0.05
IGL00920:Cd209e APN 8 3,899,187 (GRCm39) missense probably damaging 1.00
IGL01132:Cd209e APN 8 3,901,274 (GRCm39) missense probably benign 0.18
IGL02499:Cd209e APN 8 3,904,238 (GRCm39) missense probably benign
R0268:Cd209e UTSW 8 3,899,125 (GRCm39) missense probably benign 0.34
R0540:Cd209e UTSW 8 3,901,265 (GRCm39) missense probably benign 0.04
R0744:Cd209e UTSW 8 3,903,205 (GRCm39) missense probably benign 0.00
R0836:Cd209e UTSW 8 3,903,205 (GRCm39) missense probably benign 0.00
R1241:Cd209e UTSW 8 3,899,124 (GRCm39) missense probably damaging 0.99
R1367:Cd209e UTSW 8 3,899,084 (GRCm39) makesense probably null
R2040:Cd209e UTSW 8 3,899,158 (GRCm39) missense probably damaging 1.00
R2136:Cd209e UTSW 8 3,903,248 (GRCm39) missense probably benign 0.00
R4787:Cd209e UTSW 8 3,901,181 (GRCm39) missense probably null 0.69
R6283:Cd209e UTSW 8 3,899,212 (GRCm39) nonsense probably null
R6338:Cd209e UTSW 8 3,899,154 (GRCm39) missense probably damaging 1.00
R6894:Cd209e UTSW 8 3,903,569 (GRCm39) missense possibly damaging 0.48
R8899:Cd209e UTSW 8 3,901,212 (GRCm39) nonsense probably null
R9594:Cd209e UTSW 8 3,901,183 (GRCm39) missense probably benign 0.00
Z1176:Cd209e UTSW 8 3,899,196 (GRCm39) missense probably benign 0.30
Z1177:Cd209e UTSW 8 3,901,181 (GRCm39) missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- TTTTGATTACCCACACAGGCTACAGAC -3'
(R):5'- CCACTTATCCCTGAGCATTGATAGGC -3'

Sequencing Primer
(F):5'- CTTATTTCCAAAAGGCCAGGG -3'
(R):5'- tgctgagggatggaaagaaac -3'
Posted On 2013-04-11