Incidental Mutation 'R1901:Scn11a'
ID 212225
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission 039921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R1901 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 119608102 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 1010 (K1010*)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably null
Transcript: ENSMUST00000070617
AA Change: K1010*
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: K1010*

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215718
AA Change: K1010*
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 119,945,322 (GRCm39) E466G probably damaging Het
Acacb A T 5: 114,303,795 (GRCm39) R73* probably null Het
Acta1 A T 8: 124,619,900 (GRCm39) S147T probably benign Het
Adh1 G A 3: 137,994,558 (GRCm39) V293I probably benign Het
Aldh3b3 T C 19: 4,015,130 (GRCm39) Y170H probably damaging Het
Ank3 A T 10: 69,658,167 (GRCm39) T198S probably damaging Het
Ankrd12 A T 17: 66,293,698 (GRCm39) N578K possibly damaging Het
Ano2 A T 6: 125,849,647 (GRCm39) E126D probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Cfap44 A C 16: 44,242,737 (GRCm39) T714P probably benign Het
Cnot1 T C 8: 96,469,749 (GRCm39) I1369V possibly damaging Het
Col19a1 A T 1: 24,576,078 (GRCm39) I88K unknown Het
Col1a1 G A 11: 94,837,458 (GRCm39) probably null Het
Col5a1 A G 2: 27,850,456 (GRCm39) T518A unknown Het
Cul7 T C 17: 46,966,666 (GRCm39) L365P probably damaging Het
Dlec1 T C 9: 118,931,712 (GRCm39) S44P probably damaging Het
Dock9 T C 14: 121,862,565 (GRCm39) probably null Het
Fbxl9 T C 8: 106,039,707 (GRCm39) N556S probably damaging Het
Flrt2 C A 12: 95,745,904 (GRCm39) P81T probably damaging Het
Flrt2 C T 12: 95,745,905 (GRCm39) P81L probably damaging Het
Ginm1 A G 10: 7,650,980 (GRCm39) probably null Het
Glis3 T C 19: 28,508,985 (GRCm39) N333S probably damaging Het
Glo1 T G 17: 30,815,382 (GRCm39) E144D probably benign Het
Golga1 A T 2: 38,937,792 (GRCm39) probably null Het
H2-Aa A G 17: 34,502,207 (GRCm39) I155T possibly damaging Het
Haus5 A G 7: 30,356,670 (GRCm39) S479P probably damaging Het
Il10ra A T 9: 45,167,654 (GRCm39) V299D probably benign Het
Il17re T C 6: 113,446,665 (GRCm39) V472A probably damaging Het
Il22ra1 A T 4: 135,478,219 (GRCm39) Q430L probably damaging Het
Il23r A C 6: 67,400,718 (GRCm39) D537E probably benign Het
Inppl1 T C 7: 101,472,584 (GRCm39) E1237G possibly damaging Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Klhl35 T C 7: 99,119,427 (GRCm39) L304P probably damaging Het
Krt78 A T 15: 101,855,398 (GRCm39) C804* probably null Het
Med15 G T 16: 17,491,018 (GRCm39) probably benign Het
Mettl25 A G 10: 105,661,948 (GRCm39) S341P probably damaging Het
Mroh1 A G 15: 76,320,249 (GRCm39) T1008A probably benign Het
Mug1 A G 6: 121,858,780 (GRCm39) D1166G probably benign Het
Mug2 C A 6: 122,048,801 (GRCm39) H856N probably benign Het
Naca T A 10: 127,879,590 (GRCm39) probably benign Het
Nagk G T 6: 83,776,336 (GRCm39) V184F probably damaging Het
Nav1 T G 1: 135,400,148 (GRCm39) N474T probably benign Het
Ncor2 T A 5: 125,102,489 (GRCm39) H2089L probably benign Het
Nek6 A G 2: 38,472,458 (GRCm39) I261V probably damaging Het
Neurod2 G A 11: 98,218,558 (GRCm39) T202M probably damaging Het
Nlgn2 A G 11: 69,716,726 (GRCm39) V605A probably damaging Het
Nlrp5 A C 7: 23,123,335 (GRCm39) E732A possibly damaging Het
Nt5dc1 A T 10: 34,189,667 (GRCm39) V340D probably damaging Het
Ntn4 A G 10: 93,543,234 (GRCm39) D320G possibly damaging Het
Or10al3 T A 17: 38,012,312 (GRCm39) H250Q probably damaging Het
Or10x1 A T 1: 174,196,734 (GRCm39) I84L probably benign Het
Or52l1 A G 7: 104,830,079 (GRCm39) I162T possibly damaging Het
Or52z15 T C 7: 103,332,750 (GRCm39) I265T probably damaging Het
Or5ac25 A T 16: 59,182,526 (GRCm39) D18E probably benign Het
Osbpl5 T C 7: 143,256,918 (GRCm39) D404G possibly damaging Het
Pcdhb12 T A 18: 37,570,683 (GRCm39) W610R possibly damaging Het
Pias2 T A 18: 77,185,139 (GRCm39) C66* probably null Het
Plec T A 15: 76,059,751 (GRCm39) E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,976,940 (GRCm39) probably benign Het
Ppp1r12a T A 10: 108,034,752 (GRCm39) I99N probably damaging Het
Prpf8 T G 11: 75,395,570 (GRCm39) V1899G probably damaging Het
Prr13 C A 15: 102,369,133 (GRCm39) probably benign Het
Ptchd4 A T 17: 42,814,507 (GRCm39) I803L probably benign Het
R3hdm2 T C 10: 127,334,337 (GRCm39) I947T possibly damaging Het
Raet1d A G 10: 22,247,350 (GRCm39) D142G probably damaging Het
Rbbp8nl C T 2: 179,925,106 (GRCm39) R33Q probably damaging Het
Robo1 A G 16: 72,757,092 (GRCm39) Q351R probably null Het
Rptn A T 3: 93,304,017 (GRCm39) H450L possibly damaging Het
Slc16a10 G A 10: 39,932,602 (GRCm39) Q33* probably null Het
Slc31a1 C T 4: 62,303,842 (GRCm39) probably benign Het
Slc34a1 A T 13: 55,548,963 (GRCm39) K138* probably null Het
Slc6a18 T A 13: 73,818,162 (GRCm39) E285V probably benign Het
Slco6c1 T A 1: 97,000,707 (GRCm39) T515S probably damaging Het
Snrnp40 T A 4: 130,279,768 (GRCm39) S295T probably damaging Het
Snx4 A T 16: 33,104,808 (GRCm39) Y252F possibly damaging Het
Spata18 T A 5: 73,828,482 (GRCm39) F348I probably damaging Het
Spef2 G T 15: 9,607,463 (GRCm39) R1319S probably damaging Het
Tas2r125 T C 6: 132,887,139 (GRCm39) F176L probably benign Het
Tcp10b A G 17: 13,300,513 (GRCm39) K399E possibly damaging Het
Tcstv3 A G 13: 120,779,260 (GRCm39) H53R probably damaging Het
Tnrc6c A G 11: 117,613,831 (GRCm39) K823R probably damaging Het
Trim31 A G 17: 37,212,692 (GRCm39) E221G probably benign Het
Trim47 T A 11: 115,998,605 (GRCm39) Q338L probably damaging Het
Tubgcp6 C A 15: 89,000,444 (GRCm39) R307L possibly damaging Het
Usp9y A G Y: 1,303,371 (GRCm39) probably null Het
Utp20 G T 10: 88,588,888 (GRCm39) T2427K probably benign Het
Vldlr T C 19: 27,218,709 (GRCm39) V147A probably damaging Het
Vmn1r115 C T 7: 20,578,198 (GRCm39) R238H probably benign Het
Vmn1r175 C A 7: 23,508,218 (GRCm39) R136S probably benign Het
Vmn1r53 A G 6: 90,201,268 (GRCm39) S19P possibly damaging Het
Vwa5b2 G T 16: 20,423,582 (GRCm39) S1165I possibly damaging Het
Zfp362 G T 4: 128,684,069 (GRCm39) P13T probably damaging Het
Zfp825 A G 13: 74,629,064 (GRCm39) C151R probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6057:Scn11a UTSW 9 119,594,514 (GRCm39) missense probably damaging 1.00
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGCAGGATTTCCCACAGC -3'
(R):5'- AGATGATACTTTGTGGCTTCACCTC -3'

Sequencing Primer
(F):5'- GGATTTCCCACAGCCACCC -3'
(R):5'- TCTTCCTTTTGGCTAGCAGAG -3'
Posted On 2014-06-30