Incidental Mutation 'R1901:Scn11a'
ID212225
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 119779036 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1010 (K1010*)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably null
Transcript: ENSMUST00000070617
AA Change: K1010*
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: K1010*

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000215718
AA Change: K1010*
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acacb A T 5: 114,165,734 R73* probably null Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Aldh3b3 T C 19: 3,965,130 Y170H probably damaging Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
Golga1 A T 2: 39,047,780 probably null Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Olfr685 A G 7: 105,180,872 I162T possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spata18 T A 5: 73,671,139 F348I probably damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7967:Scn11a UTSW 9 119804551 missense probably benign 0.01
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGCAGGATTTCCCACAGC -3'
(R):5'- AGATGATACTTTGTGGCTTCACCTC -3'

Sequencing Primer
(F):5'- GGATTTCCCACAGCCACCC -3'
(R):5'- TCTTCCTTTTGGCTAGCAGAG -3'
Posted On2014-06-30