Incidental Mutation 'R1901:Aldh3b3'
ID212276
Institutional Source Beutler Lab
Gene Symbol Aldh3b3
Ensembl Gene ENSMUSG00000037263
Gene Namealdehyde dehydrogenase 3 family, member B3
Synonyms1700055N04Rik
MMRRC Submission 039921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R1901 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3958645-3972103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3965130 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 170 (Y170H)
Ref Sequence ENSEMBL: ENSMUSP00000136334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179433] [ENSMUST00000189124]
Predicted Effect probably benign
Transcript: ENSMUST00000025794
SMART Domains Protein: ENSMUSP00000025794
Gene: ENSMUSG00000037263

DomainStartEndE-ValueType
PDB:4L2O|G 1 87 5e-22 PDB
SCOP:d1ad3a_ 8 82 2e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179433
AA Change: Y170H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136334
Gene: ENSMUSG00000037263
AA Change: Y170H

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 5.4e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189124
SMART Domains Protein: ENSMUSP00000140893
Gene: ENSMUSG00000037263

DomainStartEndE-ValueType
SCOP:d1ad3a_ 18 72 2e-8 SMART
PDB:1AD3|B 19 67 1e-8 PDB
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A G 7: 120,346,099 E466G probably damaging Het
Acacb A T 5: 114,165,734 R73* probably null Het
Acta1 A T 8: 123,893,161 S147T probably benign Het
Adh1 G A 3: 138,288,797 V293I probably benign Het
Ank3 A T 10: 69,822,337 T198S probably damaging Het
Ankrd12 A T 17: 65,986,703 N578K possibly damaging Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Col19a1 A T 1: 24,536,997 I88K unknown Het
Col1a1 G A 11: 94,946,632 probably null Het
Col5a1 A G 2: 27,960,444 T518A unknown Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Dlec1 T C 9: 119,102,644 S44P probably damaging Het
Dock9 T C 14: 121,625,153 probably null Het
Flrt2 C A 12: 95,779,130 P81T probably damaging Het
Flrt2 C T 12: 95,779,131 P81L probably damaging Het
Ginm1 A G 10: 7,775,216 probably null Het
Glis3 T C 19: 28,531,585 N333S probably damaging Het
Glo1 T G 17: 30,596,408 E144D probably benign Het
Golga1 A T 2: 39,047,780 probably null Het
H2-Aa A G 17: 34,283,233 I155T possibly damaging Het
Haus5 A G 7: 30,657,245 S479P probably damaging Het
Il10ra A T 9: 45,256,356 V299D probably benign Het
Il17re T C 6: 113,469,704 V472A probably damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Inppl1 T C 7: 101,823,377 E1237G possibly damaging Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl35 T C 7: 99,470,220 L304P probably damaging Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Lrrc29 T C 8: 105,313,075 N556S probably damaging Het
Med15 G T 16: 17,673,154 probably benign Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Mroh1 A G 15: 76,436,049 T1008A probably benign Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Mug2 C A 6: 122,071,842 H856N probably benign Het
Naca T A 10: 128,043,721 probably benign Het
Nagk G T 6: 83,799,354 V184F probably damaging Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncor2 T A 5: 125,025,425 H2089L probably benign Het
Nek6 A G 2: 38,582,446 I261V probably damaging Het
Neurod2 G A 11: 98,327,732 T202M probably damaging Het
Nlgn2 A G 11: 69,825,900 V605A probably damaging Het
Nlrp5 A C 7: 23,423,910 E732A possibly damaging Het
Nt5dc1 A T 10: 34,313,671 V340D probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr417 A T 1: 174,369,168 I84L probably benign Het
Olfr625-ps1 T C 7: 103,683,543 I265T probably damaging Het
Olfr685 A G 7: 105,180,872 I162T possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Pcdhb12 T A 18: 37,437,630 W610R possibly damaging Het
Pias2 T A 18: 77,097,443 C66* probably null Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Prpf8 T G 11: 75,504,744 V1899G probably damaging Het
Prr13 C A 15: 102,460,698 probably benign Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
R3hdm2 T C 10: 127,498,468 I947T possibly damaging Het
Raet1d A G 10: 22,371,451 D142G probably damaging Het
Rbbp8nl C T 2: 180,283,313 R33Q probably damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Rptn A T 3: 93,396,710 H450L possibly damaging Het
Scn11a T A 9: 119,779,036 K1010* probably null Het
Slc16a10 G A 10: 40,056,606 Q33* probably null Het
Slc31a1 C T 4: 62,385,605 probably benign Het
Slc34a1 A T 13: 55,401,150 K138* probably null Het
Slc6a18 T A 13: 73,670,043 E285V probably benign Het
Slco6c1 T A 1: 97,072,982 T515S probably damaging Het
Snrnp40 T A 4: 130,385,975 S295T probably damaging Het
Snx4 A T 16: 33,284,438 Y252F possibly damaging Het
Spata18 T A 5: 73,671,139 F348I probably damaging Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tcp10b A G 17: 13,081,626 K399E possibly damaging Het
Tcstv3 A G 13: 120,317,724 H53R probably damaging Het
Tnrc6c A G 11: 117,723,005 K823R probably damaging Het
Trim31 A G 17: 36,901,800 E221G probably benign Het
Trim47 T A 11: 116,107,779 Q338L probably damaging Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Usp9y A G Y: 1,303,371 probably null Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vldlr T C 19: 27,241,309 V147A probably damaging Het
Vmn1r115 C T 7: 20,844,273 R238H probably benign Het
Vmn1r175 C A 7: 23,808,793 R136S probably benign Het
Vmn1r53 A G 6: 90,224,286 S19P possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp362 G T 4: 128,790,276 P13T probably damaging Het
Zfp825 A G 13: 74,480,945 C151R probably damaging Het
Other mutations in Aldh3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3b3 APN 19 3965863 missense probably benign 0.02
R0395:Aldh3b3 UTSW 19 3966472 missense probably benign 0.00
R0762:Aldh3b3 UTSW 19 3965747 unclassified probably null
R1722:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R1754:Aldh3b3 UTSW 19 3968517 missense probably benign
R1853:Aldh3b3 UTSW 19 3965822 missense probably damaging 1.00
R3924:Aldh3b3 UTSW 19 3968491 missense probably damaging 1.00
R4578:Aldh3b3 UTSW 19 3964832 missense probably benign
R4689:Aldh3b3 UTSW 19 3964516 missense probably damaging 0.97
R5632:Aldh3b3 UTSW 19 3968522 utr 3 prime probably benign
R5635:Aldh3b3 UTSW 19 3968512 missense probably benign 0.17
R7422:Aldh3b3 UTSW 19 3966476 missense probably benign 0.01
R7478:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7481:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7717:Aldh3b3 UTSW 19 3963970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGAACTTGATGATCATACC -3'
(R):5'- ATTTGTGTTCCAGCAGCTGC -3'

Sequencing Primer
(F):5'- ATCATACCTTTAGTGGGGGCC -3'
(R):5'- AGCTGCCCGGTCTCCTC -3'
Posted On2014-06-30