Mutagenetix > Incidental Mutation

Incidental Mutation 'R1902:Plcb1'

212295

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

039922-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R1902 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 134813613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 38 (V38I)

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

AlphaFold

Q9Z1B3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070724
AA Change: V38I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: V38I

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110116
AA Change: V38I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: V38I

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130524

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131552
AA Change: V38I

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: V38I

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202531

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 128 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	C	T	12: 18,534,003	Q355*	probably null	Het
Acacb	A	T	5: 114,165,734	R73*	probably null	Het
Adra1a	T	C	14: 66,638,235	S220P	probably benign	Het
Ano2	A	T	6: 125,872,684	E126D	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arhgap45	C	A	10: 80,025,466	Q488K	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Atxn7l3b	A	G	10: 112,928,673	I17T	probably benign	Het
BC003331	T	A	1: 150,388,609		probably null	Het
Bpifb9a	A	T	2: 154,261,991	N118I	probably benign	Het
Btbd9	A	T	17: 30,530,228	D37E	probably damaging	Het
C8a	T	C	4: 104,856,601		probably null	Het
Capn13	G	A	17: 73,326,361	S535F	probably damaging	Het
Carns1	G	T	19: 4,166,338	P615Q	probably damaging	Het
Casz1	T	C	4: 148,936,195	I479T	possibly damaging	Het
Ccdc88a	G	T	11: 29,461,788	M532I	probably benign	Het
Cdc42bpb	T	G	12: 111,326,016	S362R	probably damaging	Het
Ceacam11	A	T	7: 17,975,327	H150L	probably benign	Het
Cfap44	A	C	16: 44,422,374	T714P	probably benign	Het
Cnot1	T	C	8: 95,743,121	I1369V	possibly damaging	Het
Cpeb1	T	C	7: 81,372,119	D92G	probably benign	Het
Cped1	T	A	6: 22,120,981		probably null	Het
Csf1r	A	G	18: 61,130,141	T896A	probably damaging	Het
Csf3r	T	C	4: 126,042,918	F658S	probably damaging	Het
Cts6	A	T	13: 61,201,515	Y126*	probably null	Het
Cul7	T	C	17: 46,655,740	L365P	probably damaging	Het
Cxcl5	T	C	5: 90,759,785	V72A	probably damaging	Het
Cyp4v3	T	A	8: 45,306,952	H521L	probably benign	Het
Dct	T	C	14: 118,034,278	N380S	probably benign	Het
Dnah1	T	C	14: 31,319,759	D85G	probably damaging	Het
Dnah7a	T	C	1: 53,535,478	D1709G	probably damaging	Het
Dnaic1	A	T	4: 41,625,319	K428*	probably null	Het
Dsc1	A	T	18: 20,095,988	V415D	probably damaging	Het
E2f8	T	C	7: 48,871,172	H467R	probably benign	Het
Eddm3b	T	A	14: 51,116,864	I103N	probably damaging	Het
Fam71b	A	T	11: 46,407,011	T381S	probably benign	Het
Gal3st2c	T	G	1: 94,008,889	N185K	probably damaging	Het
Ganc	T	C	2: 120,446,482	L675P	probably damaging	Het
Gdf9	G	A	11: 53,436,953	M245I	probably benign	Het
Gm21886	G	A	18: 80,089,418	T175I	probably damaging	Het
Gria2	A	G	3: 80,722,108	L269P	probably damaging	Het
Grm8	T	C	6: 27,429,482	Y471C	probably damaging	Het
Gucy2g	T	A	19: 55,210,237	T825S	probably benign	Het
H2-Bl	A	T	17: 36,083,953	M16K	probably damaging	Het
Iffo2	T	C	4: 139,607,701	S124P	probably damaging	Het
Igf1r	T	C	7: 68,201,249	Y931H	possibly damaging	Het
Il22ra1	A	T	4: 135,750,908	Q430L	probably damaging	Het
Il23r	A	C	6: 67,423,734	D537E	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Itgb4	T	C	11: 115,980,738	V179A	probably damaging	Het
Itpr2	T	A	6: 146,229,703	H1968L	probably damaging	Het
Kdm4a	A	G	4: 118,160,399	V490A	probably benign	Het
Kif13a	A	T	13: 46,788,162	D946E	probably benign	Het
Klhl22	T	A	16: 17,771,787	I104N	probably damaging	Het
Klk6	A	C	7: 43,826,057	M1L	probably benign	Het
Krt78	A	T	15: 101,946,963	C804*	probably null	Het
Larp7	A	T	3: 127,540,578	N533K	probably damaging	Het
Lrit3	T	C	3: 129,791,246	T288A	probably benign	Het
Lrp11	T	A	10: 7,623,780	L245Q	probably damaging	Het
Lrp1b	T	C	2: 40,860,661	S2964G	probably damaging	Het
Lrrc66	C	T	5: 73,607,622	V693M	probably damaging	Het
Macf1	T	A	4: 123,471,165	M3268L	probably benign	Het
Mad1l1	A	G	5: 140,303,688	S161P	possibly damaging	Het
Mettl25	A	G	10: 105,826,087	S341P	probably damaging	Het
Morc3	A	G	16: 93,870,497	T588A	probably damaging	Het
Mospd3	A	G	5: 137,600,415	S21P	probably damaging	Het
Mrpl57	T	A	14: 57,826,729	F71L	probably damaging	Het
Mtbp	T	C	15: 55,606,715	L594S	probably damaging	Het
Mthfd2	T	C	6: 83,306,731	N323S	probably damaging	Het
Muc5b	G	T	7: 141,864,105	S3596I	possibly damaging	Het
Mug1	A	G	6: 121,881,821	D1166G	probably benign	Het
Nav1	T	G	1: 135,472,410	N474T	probably benign	Het
Ncoa1	A	T	12: 4,339,049	D75E	possibly damaging	Het
Ncor1	A	C	11: 62,338,158	I958S	probably damaging	Het
Nefm	T	C	14: 68,124,114	S234G	probably benign	Het
Nlrp4c	T	C	7: 6,065,819	S240P	probably damaging	Het
Nox3	C	T	17: 3,670,017	V298M	probably damaging	Het
Ntn4	A	G	10: 93,707,372	D320G	possibly damaging	Het
Nudt13	C	G	14: 20,310,641	T174R	probably damaging	Het
Olfr1002	T	C	2: 85,647,857	S155G	possibly damaging	Het
Olfr119	T	A	17: 37,701,421	H250Q	probably damaging	Het
Olfr1245	A	T	2: 89,575,603	L41Q	possibly damaging	Het
Olfr1512	T	G	14: 52,372,717	Q112P	possibly damaging	Het
Olfr209	A	T	16: 59,362,163	D18E	probably benign	Het
Olfr355	T	C	2: 36,927,185	I310V	probably benign	Het
Olfr430	T	C	1: 174,070,126	V276A	probably damaging	Het
Olfr437	T	A	6: 43,167,723		probably null	Het
Olfr812	G	T	10: 129,842,506	P179T	probably benign	Het
Olfr967	T	C	9: 39,750,806	V140A	probably benign	Het
Opn1sw	T	A	6: 29,379,804	N144Y	possibly damaging	Het
Osbpl5	T	C	7: 143,703,181	D404G	possibly damaging	Het
Parp14	C	T	16: 35,853,518		probably null	Het
Pde3a	C	A	6: 141,498,770	N1101K	probably benign	Het
Plec	T	A	15: 76,175,551	E3417D	probably damaging	Het
Ppfibp2	C	T	7: 107,746,378	P869L	probably damaging	Het
Ppp1r12a	T	A	10: 108,198,891	I99N	probably damaging	Het
Pramel5	G	A	4: 144,273,863	Q48*	probably null	Het
Prr13	C	A	15: 102,460,698		probably benign	Het
Psg22	T	A	7: 18,724,438	Y312*	probably null	Het
Ptchd4	A	T	17: 42,503,616	I803L	probably benign	Het
Rasa4	A	G	5: 136,091,238	D56G	probably benign	Het
Rif1	T	A	2: 52,116,673	N2206K	possibly damaging	Het
Robo1	A	G	16: 72,960,204	Q351R	probably null	Het
Samd4	T	C	14: 47,074,128	F81S	probably damaging	Het
Sh3pxd2b	T	C	11: 32,423,559	*909Q	probably null	Het
Slc25a45	A	G	19: 5,884,522	R173G	probably damaging	Het
Smarca1	G	A	X: 47,849,963	Q723*	probably null	Het
Smoc1	T	C	12: 81,104,671	I54T	probably benign	Het
Spef2	G	T	15: 9,607,377	R1319S	probably damaging	Het
Steap3	T	G	1: 120,241,734	I240L	probably benign	Het
Stmn4	C	T	14: 66,355,609	L13F	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Syt3	T	C	7: 44,390,516	S58P	possibly damaging	Het
Tas2r125	T	C	6: 132,910,176	F176L	probably benign	Het
Tbc1d19	T	A	5: 53,829,353	C35S	probably benign	Het
Tcaf3	T	C	6: 42,593,552	E422G	possibly damaging	Het
Tekt4	T	A	17: 25,471,858	F46Y	possibly damaging	Het
Tnfaip3	T	C	10: 19,008,189	K148E	probably benign	Het
Trrap	T	G	5: 144,816,053	I1813R	probably damaging	Het
Ttc29	A	G	8: 78,251,732	E137G	probably benign	Het
Tubgcp6	C	A	15: 89,116,241	R307L	possibly damaging	Het
Tyro3	T	C	2: 119,801,695	I81T	possibly damaging	Het
Upp2	T	G	2: 58,771,452	M71R	probably damaging	Het
Utp20	G	T	10: 88,753,026	T2427K	probably benign	Het
Vcl	T	A	14: 20,982,699	L122Q	probably damaging	Het
Vmn1r213	A	C	13: 23,012,306	N353T	possibly damaging	Het
Vwa5b2	G	T	16: 20,604,832	S1165I	possibly damaging	Het
Zfp869	T	C	8: 69,707,438	K162E	probably benign	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
BB001:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
BB011:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2016:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4552:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R4946:Plcb1	UTSW	2	135345095	missense	probably benign	0.01
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5151:Plcb1	UTSW	2	135262245	missense	probably benign	0.28
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6531:Plcb1	UTSW	2	135325802	critical splice donor site	probably null
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R6976:Plcb1	UTSW	2	135262239	missense	possibly damaging	0.75
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R7924:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
R8099:Plcb1	UTSW	2	135251734	missense	possibly damaging	0.68
R8299:Plcb1	UTSW	2	135335476	missense	probably damaging	1.00
R8394:Plcb1	UTSW	2	135317790	missense	probably damaging	1.00
R8439:Plcb1	UTSW	2	135250052	critical splice donor site	probably null
R8549:Plcb1	UTSW	2	135364933	missense	probably benign	0.00
R8693:Plcb1	UTSW	2	135252776	missense	probably benign	0.00
R8750:Plcb1	UTSW	2	135335449	missense	probably damaging	1.00
R8817:Plcb1	UTSW	2	135333509	intron	probably benign
R8950:Plcb1	UTSW	2	135337519	missense	probably damaging	1.00
R9146:Plcb1	UTSW	2	135340695	missense	probably damaging	1.00
R9301:Plcb1	UTSW	2	135325690	missense	possibly damaging	0.96
R9311:Plcb1	UTSW	2	135347465	missense	probably benign	0.00
R9459:Plcb1	UTSW	2	135322638	missense	probably benign	0.03
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CATGAGTCATTGCTTCAGGTG -3'
(R):5'- TGAAAAGTCCTAAGGCCCTTAGC -3'

Sequencing Primer
(F):5'- TGCTTCAGGTGTATGATGAATAATTC -3'
(R):5'- CCTGAGTCTCTGGAAGTAGAATC -3'

Posted On

2014-06-30