Mutagenetix > Incidental Mutation

Incidental Mutation 'R1902:Acacb'

212316

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039922-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1902 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 114165734 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 73 (R73*)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably null
Transcript: ENSMUST00000031583
AA Change: R73*

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: R73*

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102582
AA Change: R73*

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: R73*

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 128 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730507C01Rik	C	T	12: 18,534,003	Q355*	probably null	Het
Adra1a	T	C	14: 66,638,235	S220P	probably benign	Het
Ano2	A	T	6: 125,872,684	E126D	probably damaging	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arhgap45	C	A	10: 80,025,466	Q488K	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Atxn7l3b	A	G	10: 112,928,673	I17T	probably benign	Het
BC003331	T	A	1: 150,388,609		probably null	Het
Bpifb9a	A	T	2: 154,261,991	N118I	probably benign	Het
Btbd9	A	T	17: 30,530,228	D37E	probably damaging	Het
C8a	T	C	4: 104,856,601		probably null	Het
Capn13	G	A	17: 73,326,361	S535F	probably damaging	Het
Carns1	G	T	19: 4,166,338	P615Q	probably damaging	Het
Casz1	T	C	4: 148,936,195	I479T	possibly damaging	Het
Ccdc88a	G	T	11: 29,461,788	M532I	probably benign	Het
Cdc42bpb	T	G	12: 111,326,016	S362R	probably damaging	Het
Ceacam11	A	T	7: 17,975,327	H150L	probably benign	Het
Cfap44	A	C	16: 44,422,374	T714P	probably benign	Het
Cnot1	T	C	8: 95,743,121	I1369V	possibly damaging	Het
Cpeb1	T	C	7: 81,372,119	D92G	probably benign	Het
Cped1	T	A	6: 22,120,981		probably null	Het
Csf1r	A	G	18: 61,130,141	T896A	probably damaging	Het
Csf3r	T	C	4: 126,042,918	F658S	probably damaging	Het
Cts6	A	T	13: 61,201,515	Y126*	probably null	Het
Cul7	T	C	17: 46,655,740	L365P	probably damaging	Het
Cxcl5	T	C	5: 90,759,785	V72A	probably damaging	Het
Cyp4v3	T	A	8: 45,306,952	H521L	probably benign	Het
Dct	T	C	14: 118,034,278	N380S	probably benign	Het
Dnah1	T	C	14: 31,319,759	D85G	probably damaging	Het
Dnah7a	T	C	1: 53,535,478	D1709G	probably damaging	Het
Dnaic1	A	T	4: 41,625,319	K428*	probably null	Het
Dsc1	A	T	18: 20,095,988	V415D	probably damaging	Het
E2f8	T	C	7: 48,871,172	H467R	probably benign	Het
Eddm3b	T	A	14: 51,116,864	I103N	probably damaging	Het
Fam71b	A	T	11: 46,407,011	T381S	probably benign	Het
Gal3st2c	T	G	1: 94,008,889	N185K	probably damaging	Het
Ganc	T	C	2: 120,446,482	L675P	probably damaging	Het
Gdf9	G	A	11: 53,436,953	M245I	probably benign	Het
Gm21886	G	A	18: 80,089,418	T175I	probably damaging	Het
Gria2	A	G	3: 80,722,108	L269P	probably damaging	Het
Grm8	T	C	6: 27,429,482	Y471C	probably damaging	Het
Gucy2g	T	A	19: 55,210,237	T825S	probably benign	Het
H2-Bl	A	T	17: 36,083,953	M16K	probably damaging	Het
Iffo2	T	C	4: 139,607,701	S124P	probably damaging	Het
Igf1r	T	C	7: 68,201,249	Y931H	possibly damaging	Het
Il22ra1	A	T	4: 135,750,908	Q430L	probably damaging	Het
Il23r	A	C	6: 67,423,734	D537E	probably benign	Het
Ip6k1	G	A	9: 108,040,996	E77K	possibly damaging	Het
Itgb4	T	C	11: 115,980,738	V179A	probably damaging	Het
Itpr2	T	A	6: 146,229,703	H1968L	probably damaging	Het
Kdm4a	A	G	4: 118,160,399	V490A	probably benign	Het
Kif13a	A	T	13: 46,788,162	D946E	probably benign	Het
Klhl22	T	A	16: 17,771,787	I104N	probably damaging	Het
Klk6	A	C	7: 43,826,057	M1L	probably benign	Het
Krt78	A	T	15: 101,946,963	C804*	probably null	Het
Larp7	A	T	3: 127,540,578	N533K	probably damaging	Het
Lrit3	T	C	3: 129,791,246	T288A	probably benign	Het
Lrp11	T	A	10: 7,623,780	L245Q	probably damaging	Het
Lrp1b	T	C	2: 40,860,661	S2964G	probably damaging	Het
Lrrc66	C	T	5: 73,607,622	V693M	probably damaging	Het
Macf1	T	A	4: 123,471,165	M3268L	probably benign	Het
Mad1l1	A	G	5: 140,303,688	S161P	possibly damaging	Het
Mettl25	A	G	10: 105,826,087	S341P	probably damaging	Het
Morc3	A	G	16: 93,870,497	T588A	probably damaging	Het
Mospd3	A	G	5: 137,600,415	S21P	probably damaging	Het
Mrpl57	T	A	14: 57,826,729	F71L	probably damaging	Het
Mtbp	T	C	15: 55,606,715	L594S	probably damaging	Het
Mthfd2	T	C	6: 83,306,731	N323S	probably damaging	Het
Muc5b	G	T	7: 141,864,105	S3596I	possibly damaging	Het
Mug1	A	G	6: 121,881,821	D1166G	probably benign	Het
Nav1	T	G	1: 135,472,410	N474T	probably benign	Het
Ncoa1	A	T	12: 4,339,049	D75E	possibly damaging	Het
Ncor1	A	C	11: 62,338,158	I958S	probably damaging	Het
Nefm	T	C	14: 68,124,114	S234G	probably benign	Het
Nlrp4c	T	C	7: 6,065,819	S240P	probably damaging	Het
Nox3	C	T	17: 3,670,017	V298M	probably damaging	Het
Ntn4	A	G	10: 93,707,372	D320G	possibly damaging	Het
Nudt13	C	G	14: 20,310,641	T174R	probably damaging	Het
Olfr1002	T	C	2: 85,647,857	S155G	possibly damaging	Het
Olfr119	T	A	17: 37,701,421	H250Q	probably damaging	Het
Olfr1245	A	T	2: 89,575,603	L41Q	possibly damaging	Het
Olfr1512	T	G	14: 52,372,717	Q112P	possibly damaging	Het
Olfr209	A	T	16: 59,362,163	D18E	probably benign	Het
Olfr355	T	C	2: 36,927,185	I310V	probably benign	Het
Olfr430	T	C	1: 174,070,126	V276A	probably damaging	Het
Olfr437	T	A	6: 43,167,723		probably null	Het
Olfr812	G	T	10: 129,842,506	P179T	probably benign	Het
Olfr967	T	C	9: 39,750,806	V140A	probably benign	Het
Opn1sw	T	A	6: 29,379,804	N144Y	possibly damaging	Het
Osbpl5	T	C	7: 143,703,181	D404G	possibly damaging	Het
Parp14	C	T	16: 35,853,518		probably null	Het
Pde3a	C	A	6: 141,498,770	N1101K	probably benign	Het
Plcb1	G	A	2: 134,813,613	V38I	possibly damaging	Het
Plec	T	A	15: 76,175,551	E3417D	probably damaging	Het
Ppfibp2	C	T	7: 107,746,378	P869L	probably damaging	Het
Ppp1r12a	T	A	10: 108,198,891	I99N	probably damaging	Het
Pramel5	G	A	4: 144,273,863	Q48*	probably null	Het
Prr13	C	A	15: 102,460,698		probably benign	Het
Psg22	T	A	7: 18,724,438	Y312*	probably null	Het
Ptchd4	A	T	17: 42,503,616	I803L	probably benign	Het
Rasa4	A	G	5: 136,091,238	D56G	probably benign	Het
Rif1	T	A	2: 52,116,673	N2206K	possibly damaging	Het
Robo1	A	G	16: 72,960,204	Q351R	probably null	Het
Samd4	T	C	14: 47,074,128	F81S	probably damaging	Het
Sh3pxd2b	T	C	11: 32,423,559	*909Q	probably null	Het
Slc25a45	A	G	19: 5,884,522	R173G	probably damaging	Het
Smarca1	G	A	X: 47,849,963	Q723*	probably null	Het
Smoc1	T	C	12: 81,104,671	I54T	probably benign	Het
Spef2	G	T	15: 9,607,377	R1319S	probably damaging	Het
Steap3	T	G	1: 120,241,734	I240L	probably benign	Het
Stmn4	C	T	14: 66,355,609	L13F	probably damaging	Het
Stxbp5	C	A	10: 9,812,298	V420F	possibly damaging	Het
Syt3	T	C	7: 44,390,516	S58P	possibly damaging	Het
Tas2r125	T	C	6: 132,910,176	F176L	probably benign	Het
Tbc1d19	T	A	5: 53,829,353	C35S	probably benign	Het
Tcaf3	T	C	6: 42,593,552	E422G	possibly damaging	Het
Tekt4	T	A	17: 25,471,858	F46Y	possibly damaging	Het
Tnfaip3	T	C	10: 19,008,189	K148E	probably benign	Het
Trrap	T	G	5: 144,816,053	I1813R	probably damaging	Het
Ttc29	A	G	8: 78,251,732	E137G	probably benign	Het
Tubgcp6	C	A	15: 89,116,241	R307L	possibly damaging	Het
Tyro3	T	C	2: 119,801,695	I81T	possibly damaging	Het
Upp2	T	G	2: 58,771,452	M71R	probably damaging	Het
Utp20	G	T	10: 88,753,026	T2427K	probably benign	Het
Vcl	T	A	14: 20,982,699	L122Q	probably damaging	Het
Vmn1r213	A	C	13: 23,012,306	N353T	possibly damaging	Het
Vwa5b2	G	T	16: 20,604,832	S1165I	possibly damaging	Het
Zfp869	T	C	8: 69,707,438	K162E	probably benign	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGCCTGAATGGTCTTGCTTC -3'
(R):5'- AGCCCAGGATAAAGCTGGTC -3'

Sequencing Primer
(F):5'- GAATGGTCTTGCTTCTCTTTCTGAC -3'
(R):5'- CCCAGGATAAAGCTGGTCATCAG -3'

Posted On

2014-06-30