Incidental Mutation 'R1902:Tcaf3'
ID 212325
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 039922-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R1902 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42570486 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 422 (E422G)
Ref Sequence ENSEMBL: ENSMUSP00000064060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect possibly damaging
Transcript: ENSMUST00000069023
AA Change: E422G

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: E422G

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134707
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,584,004 (GRCm39) Q355* probably null Het
Acacb A T 5: 114,303,795 (GRCm39) R73* probably null Het
Adra1a T C 14: 66,875,684 (GRCm39) S220P probably benign Het
Ano2 A T 6: 125,849,647 (GRCm39) E126D probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgap45 C A 10: 79,861,300 (GRCm39) Q488K probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Atxn7l3b A G 10: 112,764,578 (GRCm39) I17T probably benign Het
Bpifb9a A T 2: 154,103,911 (GRCm39) N118I probably benign Het
Btbd9 A T 17: 30,749,202 (GRCm39) D37E probably damaging Het
C8a T C 4: 104,713,798 (GRCm39) probably null Het
Capn13 G A 17: 73,633,356 (GRCm39) S535F probably damaging Het
Carns1 G T 19: 4,216,337 (GRCm39) P615Q probably damaging Het
Casz1 T C 4: 149,020,652 (GRCm39) I479T possibly damaging Het
Ccdc88a G T 11: 29,411,788 (GRCm39) M532I probably benign Het
Cdc42bpb T G 12: 111,292,450 (GRCm39) S362R probably damaging Het
Ceacam11 A T 7: 17,709,252 (GRCm39) H150L probably benign Het
Cfap44 A C 16: 44,242,737 (GRCm39) T714P probably benign Het
Cnot1 T C 8: 96,469,749 (GRCm39) I1369V possibly damaging Het
Cpeb1 T C 7: 81,021,867 (GRCm39) D92G probably benign Het
Cped1 T A 6: 22,120,980 (GRCm39) probably null Het
Csf1r A G 18: 61,263,213 (GRCm39) T896A probably damaging Het
Csf3r T C 4: 125,936,711 (GRCm39) F658S probably damaging Het
Cts6 A T 13: 61,349,329 (GRCm39) Y126* probably null Het
Cul7 T C 17: 46,966,666 (GRCm39) L365P probably damaging Het
Cxcl5 T C 5: 90,907,644 (GRCm39) V72A probably damaging Het
Cyp4v3 T A 8: 45,759,989 (GRCm39) H521L probably benign Het
Dct T C 14: 118,271,690 (GRCm39) N380S probably benign Het
Dnah1 T C 14: 31,041,716 (GRCm39) D85G probably damaging Het
Dnah7a T C 1: 53,574,637 (GRCm39) D1709G probably damaging Het
Dnai1 A T 4: 41,625,319 (GRCm39) K428* probably null Het
Dsc1 A T 18: 20,229,045 (GRCm39) V415D probably damaging Het
E2f8 T C 7: 48,520,920 (GRCm39) H467R probably benign Het
Eddm3b T A 14: 51,354,321 (GRCm39) I103N probably damaging Het
Gal3st2c T G 1: 93,936,611 (GRCm39) N185K probably damaging Het
Ganc T C 2: 120,276,963 (GRCm39) L675P probably damaging Het
Garin3 A T 11: 46,297,838 (GRCm39) T381S probably benign Het
Gdf9 G A 11: 53,327,780 (GRCm39) M245I probably benign Het
Gm21886 G A 18: 80,132,633 (GRCm39) T175I probably damaging Het
Gria2 A G 3: 80,629,415 (GRCm39) L269P probably damaging Het
Grm8 T C 6: 27,429,481 (GRCm39) Y471C probably damaging Het
Gucy2g T A 19: 55,198,669 (GRCm39) T825S probably benign Het
H2-T13 A T 17: 36,394,845 (GRCm39) M16K probably damaging Het
Iffo2 T C 4: 139,335,012 (GRCm39) S124P probably damaging Het
Igf1r T C 7: 67,850,997 (GRCm39) Y931H possibly damaging Het
Il22ra1 A T 4: 135,478,219 (GRCm39) Q430L probably damaging Het
Il23r A C 6: 67,400,718 (GRCm39) D537E probably benign Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Itgb4 T C 11: 115,871,564 (GRCm39) V179A probably damaging Het
Itpr2 T A 6: 146,131,201 (GRCm39) H1968L probably damaging Het
Kdm4a A G 4: 118,017,596 (GRCm39) V490A probably benign Het
Kif13a A T 13: 46,941,638 (GRCm39) D946E probably benign Het
Klhl22 T A 16: 17,589,651 (GRCm39) I104N probably damaging Het
Klk6 A C 7: 43,475,481 (GRCm39) M1L probably benign Het
Krt78 A T 15: 101,855,398 (GRCm39) C804* probably null Het
Larp7 A T 3: 127,334,227 (GRCm39) N533K probably damaging Het
Lrit3 T C 3: 129,584,895 (GRCm39) T288A probably benign Het
Lrp11 T A 10: 7,499,544 (GRCm39) L245Q probably damaging Het
Lrp1b T C 2: 40,750,673 (GRCm39) S2964G probably damaging Het
Lrrc66 C T 5: 73,764,965 (GRCm39) V693M probably damaging Het
Macf1 T A 4: 123,364,958 (GRCm39) M3268L probably benign Het
Mad1l1 A G 5: 140,289,443 (GRCm39) S161P possibly damaging Het
Mettl25 A G 10: 105,661,948 (GRCm39) S341P probably damaging Het
Morc3 A G 16: 93,667,385 (GRCm39) T588A probably damaging Het
Mospd3 A G 5: 137,598,677 (GRCm39) S21P probably damaging Het
Mrpl57 T A 14: 58,064,186 (GRCm39) F71L probably damaging Het
Mtbp T C 15: 55,470,111 (GRCm39) L594S probably damaging Het
Mthfd2 T C 6: 83,283,713 (GRCm39) N323S probably damaging Het
Muc5b G T 7: 141,417,842 (GRCm39) S3596I possibly damaging Het
Mug1 A G 6: 121,858,780 (GRCm39) D1166G probably benign Het
Nav1 T G 1: 135,400,148 (GRCm39) N474T probably benign Het
Ncoa1 A T 12: 4,389,049 (GRCm39) D75E possibly damaging Het
Ncor1 A C 11: 62,228,984 (GRCm39) I958S probably damaging Het
Nefm T C 14: 68,361,563 (GRCm39) S234G probably benign Het
Nlrp4c T C 7: 6,068,818 (GRCm39) S240P probably damaging Het
Nox3 C T 17: 3,720,292 (GRCm39) V298M probably damaging Het
Ntn4 A G 10: 93,543,234 (GRCm39) D320G possibly damaging Het
Nudt13 C G 14: 20,360,709 (GRCm39) T174R probably damaging Het
Odr4 T A 1: 150,264,360 (GRCm39) probably null Het
Opn1sw T A 6: 29,379,803 (GRCm39) N144Y possibly damaging Het
Or10al3 T A 17: 38,012,312 (GRCm39) H250Q probably damaging Het
Or10g3 T G 14: 52,610,174 (GRCm39) Q112P possibly damaging Het
Or1l8 T C 2: 36,817,197 (GRCm39) I310V probably benign Het
Or2a52 T A 6: 43,144,657 (GRCm39) probably null Het
Or4a72 A T 2: 89,405,947 (GRCm39) L41Q possibly damaging Het
Or5ac25 A T 16: 59,182,526 (GRCm39) D18E probably benign Het
Or5g25 T C 2: 85,478,201 (GRCm39) S155G possibly damaging Het
Or6c216 G T 10: 129,678,375 (GRCm39) P179T probably benign Het
Or6n2 T C 1: 173,897,692 (GRCm39) V276A probably damaging Het
Or8g4 T C 9: 39,662,102 (GRCm39) V140A probably benign Het
Osbpl5 T C 7: 143,256,918 (GRCm39) D404G possibly damaging Het
Parp14 C T 16: 35,673,888 (GRCm39) probably null Het
Pde3a C A 6: 141,444,496 (GRCm39) N1101K probably benign Het
Plcb1 G A 2: 134,655,533 (GRCm39) V38I possibly damaging Het
Plec T A 15: 76,059,751 (GRCm39) E3417D probably damaging Het
Ppfibp2 C T 7: 107,345,585 (GRCm39) P869L probably damaging Het
Ppp1r12a T A 10: 108,034,752 (GRCm39) I99N probably damaging Het
Pramel5 G A 4: 144,000,433 (GRCm39) Q48* probably null Het
Prr13 C A 15: 102,369,133 (GRCm39) probably benign Het
Psg22 T A 7: 18,458,363 (GRCm39) Y312* probably null Het
Ptchd4 A T 17: 42,814,507 (GRCm39) I803L probably benign Het
Rasa4 A G 5: 136,120,092 (GRCm39) D56G probably benign Het
Rif1 T A 2: 52,006,685 (GRCm39) N2206K possibly damaging Het
Robo1 A G 16: 72,757,092 (GRCm39) Q351R probably null Het
Samd4 T C 14: 47,311,585 (GRCm39) F81S probably damaging Het
Sh3pxd2b T C 11: 32,373,559 (GRCm39) *909Q probably null Het
Slc25a45 A G 19: 5,934,550 (GRCm39) R173G probably damaging Het
Smarca1 G A X: 46,938,840 (GRCm39) Q723* probably null Het
Smoc1 T C 12: 81,151,445 (GRCm39) I54T probably benign Het
Spef2 G T 15: 9,607,463 (GRCm39) R1319S probably damaging Het
Steap3 T G 1: 120,169,464 (GRCm39) I240L probably benign Het
Stmn4 C T 14: 66,593,058 (GRCm39) L13F probably damaging Het
Stxbp5 C A 10: 9,688,042 (GRCm39) V420F possibly damaging Het
Syt3 T C 7: 44,039,940 (GRCm39) S58P possibly damaging Het
Tas2r125 T C 6: 132,887,139 (GRCm39) F176L probably benign Het
Tbc1d19 T A 5: 53,986,695 (GRCm39) C35S probably benign Het
Tekt4 T A 17: 25,690,832 (GRCm39) F46Y possibly damaging Het
Tnfaip3 T C 10: 18,883,937 (GRCm39) K148E probably benign Het
Trrap T G 5: 144,752,863 (GRCm39) I1813R probably damaging Het
Ttc29 A G 8: 78,978,361 (GRCm39) E137G probably benign Het
Tubgcp6 C A 15: 89,000,444 (GRCm39) R307L possibly damaging Het
Tyro3 T C 2: 119,632,176 (GRCm39) I81T possibly damaging Het
Upp2 T G 2: 58,661,464 (GRCm39) M71R probably damaging Het
Utp20 G T 10: 88,588,888 (GRCm39) T2427K probably benign Het
Vcl T A 14: 21,032,767 (GRCm39) L122Q probably damaging Het
Vmn1r213 A C 13: 23,196,476 (GRCm39) N353T possibly damaging Het
Vwa5b2 G T 16: 20,423,582 (GRCm39) S1165I possibly damaging Het
Zfp869 T C 8: 70,160,088 (GRCm39) K162E probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5425:Tcaf3 UTSW 6 42,573,697 (GRCm39) missense probably damaging 1.00
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAAAGCCTGTGAGCTGC -3'
(R):5'- TAATTGGTGCAGAGGCCTGG -3'

Sequencing Primer
(F):5'- CGATCGGGTATTGTTCAGTCACAC -3'
(R):5'- TGCAGAGGCCTGGTCGTG -3'
Posted On 2014-06-30