Incidental Mutation 'R1902:Cnot1'
ID 212352
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 039922-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1902 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 96446079-96534092 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96469749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1369 (I1369V)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000068452
AA Change: I1369V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I1369V

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083155
Predicted Effect probably benign
Transcript: ENSMUST00000098473
AA Change: I1374V

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I1374V

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: I1367V

PolyPhen 2 Score 0.322 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect probably benign
Transcript: ENSMUST00000213006
AA Change: I1374V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,584,004 (GRCm39) Q355* probably null Het
Acacb A T 5: 114,303,795 (GRCm39) R73* probably null Het
Adra1a T C 14: 66,875,684 (GRCm39) S220P probably benign Het
Ano2 A T 6: 125,849,647 (GRCm39) E126D probably damaging Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arhgap45 C A 10: 79,861,300 (GRCm39) Q488K probably damaging Het
Arhgef7 C A 8: 11,858,713 (GRCm39) probably null Het
Atxn7l3b A G 10: 112,764,578 (GRCm39) I17T probably benign Het
Bpifb9a A T 2: 154,103,911 (GRCm39) N118I probably benign Het
Btbd9 A T 17: 30,749,202 (GRCm39) D37E probably damaging Het
C8a T C 4: 104,713,798 (GRCm39) probably null Het
Capn13 G A 17: 73,633,356 (GRCm39) S535F probably damaging Het
Carns1 G T 19: 4,216,337 (GRCm39) P615Q probably damaging Het
Casz1 T C 4: 149,020,652 (GRCm39) I479T possibly damaging Het
Ccdc88a G T 11: 29,411,788 (GRCm39) M532I probably benign Het
Cdc42bpb T G 12: 111,292,450 (GRCm39) S362R probably damaging Het
Ceacam11 A T 7: 17,709,252 (GRCm39) H150L probably benign Het
Cfap44 A C 16: 44,242,737 (GRCm39) T714P probably benign Het
Cpeb1 T C 7: 81,021,867 (GRCm39) D92G probably benign Het
Cped1 T A 6: 22,120,980 (GRCm39) probably null Het
Csf1r A G 18: 61,263,213 (GRCm39) T896A probably damaging Het
Csf3r T C 4: 125,936,711 (GRCm39) F658S probably damaging Het
Cts6 A T 13: 61,349,329 (GRCm39) Y126* probably null Het
Cul7 T C 17: 46,966,666 (GRCm39) L365P probably damaging Het
Cxcl5 T C 5: 90,907,644 (GRCm39) V72A probably damaging Het
Cyp4v3 T A 8: 45,759,989 (GRCm39) H521L probably benign Het
Dct T C 14: 118,271,690 (GRCm39) N380S probably benign Het
Dnah1 T C 14: 31,041,716 (GRCm39) D85G probably damaging Het
Dnah7a T C 1: 53,574,637 (GRCm39) D1709G probably damaging Het
Dnai1 A T 4: 41,625,319 (GRCm39) K428* probably null Het
Dsc1 A T 18: 20,229,045 (GRCm39) V415D probably damaging Het
E2f8 T C 7: 48,520,920 (GRCm39) H467R probably benign Het
Eddm3b T A 14: 51,354,321 (GRCm39) I103N probably damaging Het
Gal3st2c T G 1: 93,936,611 (GRCm39) N185K probably damaging Het
Ganc T C 2: 120,276,963 (GRCm39) L675P probably damaging Het
Garin3 A T 11: 46,297,838 (GRCm39) T381S probably benign Het
Gdf9 G A 11: 53,327,780 (GRCm39) M245I probably benign Het
Gm21886 G A 18: 80,132,633 (GRCm39) T175I probably damaging Het
Gria2 A G 3: 80,629,415 (GRCm39) L269P probably damaging Het
Grm8 T C 6: 27,429,481 (GRCm39) Y471C probably damaging Het
Gucy2g T A 19: 55,198,669 (GRCm39) T825S probably benign Het
H2-T13 A T 17: 36,394,845 (GRCm39) M16K probably damaging Het
Iffo2 T C 4: 139,335,012 (GRCm39) S124P probably damaging Het
Igf1r T C 7: 67,850,997 (GRCm39) Y931H possibly damaging Het
Il22ra1 A T 4: 135,478,219 (GRCm39) Q430L probably damaging Het
Il23r A C 6: 67,400,718 (GRCm39) D537E probably benign Het
Ip6k1 G A 9: 107,918,195 (GRCm39) E77K possibly damaging Het
Itgb4 T C 11: 115,871,564 (GRCm39) V179A probably damaging Het
Itpr2 T A 6: 146,131,201 (GRCm39) H1968L probably damaging Het
Kdm4a A G 4: 118,017,596 (GRCm39) V490A probably benign Het
Kif13a A T 13: 46,941,638 (GRCm39) D946E probably benign Het
Klhl22 T A 16: 17,589,651 (GRCm39) I104N probably damaging Het
Klk6 A C 7: 43,475,481 (GRCm39) M1L probably benign Het
Krt78 A T 15: 101,855,398 (GRCm39) C804* probably null Het
Larp7 A T 3: 127,334,227 (GRCm39) N533K probably damaging Het
Lrit3 T C 3: 129,584,895 (GRCm39) T288A probably benign Het
Lrp11 T A 10: 7,499,544 (GRCm39) L245Q probably damaging Het
Lrp1b T C 2: 40,750,673 (GRCm39) S2964G probably damaging Het
Lrrc66 C T 5: 73,764,965 (GRCm39) V693M probably damaging Het
Macf1 T A 4: 123,364,958 (GRCm39) M3268L probably benign Het
Mad1l1 A G 5: 140,289,443 (GRCm39) S161P possibly damaging Het
Mettl25 A G 10: 105,661,948 (GRCm39) S341P probably damaging Het
Morc3 A G 16: 93,667,385 (GRCm39) T588A probably damaging Het
Mospd3 A G 5: 137,598,677 (GRCm39) S21P probably damaging Het
Mrpl57 T A 14: 58,064,186 (GRCm39) F71L probably damaging Het
Mtbp T C 15: 55,470,111 (GRCm39) L594S probably damaging Het
Mthfd2 T C 6: 83,283,713 (GRCm39) N323S probably damaging Het
Muc5b G T 7: 141,417,842 (GRCm39) S3596I possibly damaging Het
Mug1 A G 6: 121,858,780 (GRCm39) D1166G probably benign Het
Nav1 T G 1: 135,400,148 (GRCm39) N474T probably benign Het
Ncoa1 A T 12: 4,389,049 (GRCm39) D75E possibly damaging Het
Ncor1 A C 11: 62,228,984 (GRCm39) I958S probably damaging Het
Nefm T C 14: 68,361,563 (GRCm39) S234G probably benign Het
Nlrp4c T C 7: 6,068,818 (GRCm39) S240P probably damaging Het
Nox3 C T 17: 3,720,292 (GRCm39) V298M probably damaging Het
Ntn4 A G 10: 93,543,234 (GRCm39) D320G possibly damaging Het
Nudt13 C G 14: 20,360,709 (GRCm39) T174R probably damaging Het
Odr4 T A 1: 150,264,360 (GRCm39) probably null Het
Opn1sw T A 6: 29,379,803 (GRCm39) N144Y possibly damaging Het
Or10al3 T A 17: 38,012,312 (GRCm39) H250Q probably damaging Het
Or10g3 T G 14: 52,610,174 (GRCm39) Q112P possibly damaging Het
Or1l8 T C 2: 36,817,197 (GRCm39) I310V probably benign Het
Or2a52 T A 6: 43,144,657 (GRCm39) probably null Het
Or4a72 A T 2: 89,405,947 (GRCm39) L41Q possibly damaging Het
Or5ac25 A T 16: 59,182,526 (GRCm39) D18E probably benign Het
Or5g25 T C 2: 85,478,201 (GRCm39) S155G possibly damaging Het
Or6c216 G T 10: 129,678,375 (GRCm39) P179T probably benign Het
Or6n2 T C 1: 173,897,692 (GRCm39) V276A probably damaging Het
Or8g4 T C 9: 39,662,102 (GRCm39) V140A probably benign Het
Osbpl5 T C 7: 143,256,918 (GRCm39) D404G possibly damaging Het
Parp14 C T 16: 35,673,888 (GRCm39) probably null Het
Pde3a C A 6: 141,444,496 (GRCm39) N1101K probably benign Het
Plcb1 G A 2: 134,655,533 (GRCm39) V38I possibly damaging Het
Plec T A 15: 76,059,751 (GRCm39) E3417D probably damaging Het
Ppfibp2 C T 7: 107,345,585 (GRCm39) P869L probably damaging Het
Ppp1r12a T A 10: 108,034,752 (GRCm39) I99N probably damaging Het
Pramel5 G A 4: 144,000,433 (GRCm39) Q48* probably null Het
Prr13 C A 15: 102,369,133 (GRCm39) probably benign Het
Psg22 T A 7: 18,458,363 (GRCm39) Y312* probably null Het
Ptchd4 A T 17: 42,814,507 (GRCm39) I803L probably benign Het
Rasa4 A G 5: 136,120,092 (GRCm39) D56G probably benign Het
Rif1 T A 2: 52,006,685 (GRCm39) N2206K possibly damaging Het
Robo1 A G 16: 72,757,092 (GRCm39) Q351R probably null Het
Samd4 T C 14: 47,311,585 (GRCm39) F81S probably damaging Het
Sh3pxd2b T C 11: 32,373,559 (GRCm39) *909Q probably null Het
Slc25a45 A G 19: 5,934,550 (GRCm39) R173G probably damaging Het
Smarca1 G A X: 46,938,840 (GRCm39) Q723* probably null Het
Smoc1 T C 12: 81,151,445 (GRCm39) I54T probably benign Het
Spef2 G T 15: 9,607,463 (GRCm39) R1319S probably damaging Het
Steap3 T G 1: 120,169,464 (GRCm39) I240L probably benign Het
Stmn4 C T 14: 66,593,058 (GRCm39) L13F probably damaging Het
Stxbp5 C A 10: 9,688,042 (GRCm39) V420F possibly damaging Het
Syt3 T C 7: 44,039,940 (GRCm39) S58P possibly damaging Het
Tas2r125 T C 6: 132,887,139 (GRCm39) F176L probably benign Het
Tbc1d19 T A 5: 53,986,695 (GRCm39) C35S probably benign Het
Tcaf3 T C 6: 42,570,486 (GRCm39) E422G possibly damaging Het
Tekt4 T A 17: 25,690,832 (GRCm39) F46Y possibly damaging Het
Tnfaip3 T C 10: 18,883,937 (GRCm39) K148E probably benign Het
Trrap T G 5: 144,752,863 (GRCm39) I1813R probably damaging Het
Ttc29 A G 8: 78,978,361 (GRCm39) E137G probably benign Het
Tubgcp6 C A 15: 89,000,444 (GRCm39) R307L possibly damaging Het
Tyro3 T C 2: 119,632,176 (GRCm39) I81T possibly damaging Het
Upp2 T G 2: 58,661,464 (GRCm39) M71R probably damaging Het
Utp20 G T 10: 88,588,888 (GRCm39) T2427K probably benign Het
Vcl T A 14: 21,032,767 (GRCm39) L122Q probably damaging Het
Vmn1r213 A C 13: 23,196,476 (GRCm39) N353T possibly damaging Het
Vwa5b2 G T 16: 20,423,582 (GRCm39) S1165I possibly damaging Het
Zfp869 T C 8: 70,160,088 (GRCm39) K162E probably benign Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 96,452,707 (GRCm39) missense probably damaging 1.00
IGL01340:Cnot1 APN 8 96,487,165 (GRCm39) missense probably damaging 1.00
IGL01457:Cnot1 APN 8 96,467,637 (GRCm39) missense probably damaging 1.00
IGL01505:Cnot1 APN 8 96,455,346 (GRCm39) missense probably damaging 0.98
IGL02401:Cnot1 APN 8 96,482,761 (GRCm39) missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 96,500,113 (GRCm39) missense probably damaging 1.00
IGL02696:Cnot1 APN 8 96,471,645 (GRCm39) missense probably benign 0.00
IGL02754:Cnot1 APN 8 96,481,706 (GRCm39) missense probably benign 0.03
IGL03092:Cnot1 APN 8 96,496,243 (GRCm39) intron probably benign
IGL03174:Cnot1 APN 8 96,487,983 (GRCm39) missense probably damaging 1.00
IGL03310:Cnot1 APN 8 96,462,308 (GRCm39) splice site probably benign
IGL03371:Cnot1 APN 8 96,501,344 (GRCm39) missense possibly damaging 0.85
Affiliate UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
Barge UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
Byproduct UTSW 8 96,472,275 (GRCm39) frame shift probably null
Chairman UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
cohort UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
Director UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
kowloon UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
Quorum UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
tugboat UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
Xiao UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
BB001:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB003:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB011:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
BB013:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0008:Cnot1 UTSW 8 96,487,969 (GRCm39) missense probably damaging 1.00
R0091:Cnot1 UTSW 8 96,489,772 (GRCm39) missense probably damaging 1.00
R0335:Cnot1 UTSW 8 96,498,628 (GRCm39) missense probably benign 0.02
R0409:Cnot1 UTSW 8 96,475,483 (GRCm39) missense probably damaging 0.96
R0445:Cnot1 UTSW 8 96,486,836 (GRCm39) missense probably damaging 1.00
R1505:Cnot1 UTSW 8 96,455,295 (GRCm39) missense probably damaging 1.00
R1517:Cnot1 UTSW 8 96,469,841 (GRCm39) missense probably benign 0.38
R1640:Cnot1 UTSW 8 96,496,460 (GRCm39) missense probably damaging 0.98
R1737:Cnot1 UTSW 8 96,474,904 (GRCm39) missense probably damaging 0.98
R1755:Cnot1 UTSW 8 96,451,205 (GRCm39) missense probably damaging 1.00
R1901:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 96,469,749 (GRCm39) missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 96,468,572 (GRCm39) missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 96,451,221 (GRCm39) missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 96,466,469 (GRCm39) missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 96,466,461 (GRCm39) missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 96,501,986 (GRCm39) missense probably damaging 1.00
R2116:Cnot1 UTSW 8 96,452,781 (GRCm39) missense probably damaging 1.00
R2191:Cnot1 UTSW 8 96,488,054 (GRCm39) missense probably damaging 0.98
R2238:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2239:Cnot1 UTSW 8 96,496,149 (GRCm39) missense probably benign 0.04
R2251:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2252:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2253:Cnot1 UTSW 8 96,489,814 (GRCm39) missense probably benign 0.00
R2315:Cnot1 UTSW 8 96,475,690 (GRCm39) missense probably damaging 1.00
R2431:Cnot1 UTSW 8 96,501,280 (GRCm39) missense probably damaging 1.00
R2988:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3109:Cnot1 UTSW 8 96,462,377 (GRCm39) missense probably damaging 0.99
R3114:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 96,470,906 (GRCm39) missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 96,500,246 (GRCm39) missense probably damaging 0.99
R4359:Cnot1 UTSW 8 96,466,476 (GRCm39) missense probably damaging 1.00
R4382:Cnot1 UTSW 8 96,496,407 (GRCm39) missense probably damaging 0.97
R4747:Cnot1 UTSW 8 96,501,310 (GRCm39) missense probably benign 0.27
R4910:Cnot1 UTSW 8 96,459,859 (GRCm39) missense probably benign 0.43
R4913:Cnot1 UTSW 8 96,489,695 (GRCm39) missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 96,448,254 (GRCm39) missense probably damaging 1.00
R5056:Cnot1 UTSW 8 96,467,636 (GRCm39) missense probably damaging 1.00
R5092:Cnot1 UTSW 8 96,479,396 (GRCm39) missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 96,486,815 (GRCm39) missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 96,483,983 (GRCm39) missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 96,470,924 (GRCm39) missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 96,460,775 (GRCm39) nonsense probably null
R5956:Cnot1 UTSW 8 96,481,606 (GRCm39) critical splice donor site probably null
R5981:Cnot1 UTSW 8 96,515,293 (GRCm39) missense probably damaging 1.00
R6093:Cnot1 UTSW 8 96,475,522 (GRCm39) missense probably benign 0.03
R6108:Cnot1 UTSW 8 96,457,048 (GRCm39) missense probably damaging 1.00
R6261:Cnot1 UTSW 8 96,468,549 (GRCm39) missense probably benign 0.00
R6632:Cnot1 UTSW 8 96,499,895 (GRCm39) intron probably benign
R6882:Cnot1 UTSW 8 96,447,054 (GRCm39) missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 96,451,160 (GRCm39) missense probably damaging 1.00
R6985:Cnot1 UTSW 8 96,460,757 (GRCm39) missense probably benign 0.13
R7210:Cnot1 UTSW 8 96,515,286 (GRCm39) missense probably damaging 1.00
R7410:Cnot1 UTSW 8 96,459,787 (GRCm39) missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 96,454,276 (GRCm39) missense probably damaging 1.00
R7624:Cnot1 UTSW 8 96,478,447 (GRCm39) missense probably damaging 1.00
R7695:Cnot1 UTSW 8 96,497,260 (GRCm39) missense probably benign 0.03
R7703:Cnot1 UTSW 8 96,486,726 (GRCm39) critical splice donor site probably null
R7771:Cnot1 UTSW 8 96,491,753 (GRCm39) missense probably damaging 0.99
R7800:Cnot1 UTSW 8 96,491,690 (GRCm39) missense probably benign 0.15
R7809:Cnot1 UTSW 8 96,478,406 (GRCm39) missense probably damaging 1.00
R7857:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7914:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7924:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7926:Cnot1 UTSW 8 96,472,275 (GRCm39) frame shift probably null
R7981:Cnot1 UTSW 8 96,489,797 (GRCm39) missense probably damaging 1.00
R8004:Cnot1 UTSW 8 96,479,380 (GRCm39) missense probably benign 0.03
R8061:Cnot1 UTSW 8 96,491,655 (GRCm39) missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 96,487,979 (GRCm39) missense probably damaging 1.00
R8269:Cnot1 UTSW 8 96,478,389 (GRCm39) missense probably damaging 1.00
R8306:Cnot1 UTSW 8 96,473,649 (GRCm39) missense probably benign 0.05
R8322:Cnot1 UTSW 8 96,496,472 (GRCm39) missense probably benign 0.00
R8427:Cnot1 UTSW 8 96,460,952 (GRCm39) missense probably benign 0.01
R8723:Cnot1 UTSW 8 96,462,907 (GRCm39) missense probably benign 0.00
R8934:Cnot1 UTSW 8 96,491,695 (GRCm39) missense probably benign 0.04
R9025:Cnot1 UTSW 8 96,475,660 (GRCm39) missense probably benign
R9179:Cnot1 UTSW 8 96,500,054 (GRCm39) missense probably benign 0.16
R9280:Cnot1 UTSW 8 96,497,227 (GRCm39) missense probably benign 0.15
R9285:Cnot1 UTSW 8 96,452,746 (GRCm39) missense probably damaging 1.00
R9299:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9337:Cnot1 UTSW 8 96,468,448 (GRCm39) missense probably damaging 1.00
R9480:Cnot1 UTSW 8 96,497,338 (GRCm39) missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 96,482,854 (GRCm39) missense probably benign 0.02
R9601:Cnot1 UTSW 8 96,482,835 (GRCm39) missense probably benign 0.02
R9629:Cnot1 UTSW 8 96,455,874 (GRCm39) missense probably damaging 0.98
R9752:Cnot1 UTSW 8 96,488,019 (GRCm39) missense probably damaging 1.00
R9764:Cnot1 UTSW 8 96,496,209 (GRCm39) missense probably benign 0.00
R9789:Cnot1 UTSW 8 96,455,772 (GRCm39) missense probably damaging 1.00
X0050:Cnot1 UTSW 8 96,469,726 (GRCm39) splice site probably null
Z1176:Cnot1 UTSW 8 96,474,905 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTTCACTGCCACAAACTAGAAG -3'
(R):5'- CTGCCCCTACTCAAGAGTTG -3'

Sequencing Primer
(F):5'- GGATCAGGATTTGATTCCCAGAACC -3'
(R):5'- ATTATCCAGCTGATTTCTTTGTTCAG -3'
Posted On 2014-06-30