Incidental Mutation 'R1902:Stxbp5'
ID212356
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission 039922-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1902 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 9812298 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 420 (V420F)
Ref Sequence ENSEMBL: ENSMUSP00000044535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038213
AA Change: V420F

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: V420F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000125200
AA Change: V420F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: V420F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000141722
AA Change: V420F

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: V420F

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219200
Meta Mutation Damage Score 0.4019 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,534,003 Q355* probably null Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adra1a T C 14: 66,638,235 S220P probably benign Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap45 C A 10: 80,025,466 Q488K probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atxn7l3b A G 10: 112,928,673 I17T probably benign Het
BC003331 T A 1: 150,388,609 probably null Het
Bpifb9a A T 2: 154,261,991 N118I probably benign Het
Btbd9 A T 17: 30,530,228 D37E probably damaging Het
C8a T C 4: 104,856,601 probably null Het
Capn13 G A 17: 73,326,361 S535F probably damaging Het
Carns1 G T 19: 4,166,338 P615Q probably damaging Het
Casz1 T C 4: 148,936,195 I479T possibly damaging Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Cdc42bpb T G 12: 111,326,016 S362R probably damaging Het
Ceacam11 A T 7: 17,975,327 H150L probably benign Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Cpeb1 T C 7: 81,372,119 D92G probably benign Het
Cped1 T A 6: 22,120,981 probably null Het
Csf1r A G 18: 61,130,141 T896A probably damaging Het
Csf3r T C 4: 126,042,918 F658S probably damaging Het
Cts6 A T 13: 61,201,515 Y126* probably null Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Cxcl5 T C 5: 90,759,785 V72A probably damaging Het
Cyp4v3 T A 8: 45,306,952 H521L probably benign Het
Dct T C 14: 118,034,278 N380S probably benign Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnaic1 A T 4: 41,625,319 K428* probably null Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
E2f8 T C 7: 48,871,172 H467R probably benign Het
Eddm3b T A 14: 51,116,864 I103N probably damaging Het
Fam71b A T 11: 46,407,011 T381S probably benign Het
Gal3st2c T G 1: 94,008,889 N185K probably damaging Het
Ganc T C 2: 120,446,482 L675P probably damaging Het
Gdf9 G A 11: 53,436,953 M245I probably benign Het
Gm21886 G A 18: 80,089,418 T175I probably damaging Het
Gria2 A G 3: 80,722,108 L269P probably damaging Het
Grm8 T C 6: 27,429,482 Y471C probably damaging Het
Gucy2g T A 19: 55,210,237 T825S probably benign Het
H2-Bl A T 17: 36,083,953 M16K probably damaging Het
Iffo2 T C 4: 139,607,701 S124P probably damaging Het
Igf1r T C 7: 68,201,249 Y931H possibly damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itgb4 T C 11: 115,980,738 V179A probably damaging Het
Itpr2 T A 6: 146,229,703 H1968L probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif13a A T 13: 46,788,162 D946E probably benign Het
Klhl22 T A 16: 17,771,787 I104N probably damaging Het
Klk6 A C 7: 43,826,057 M1L probably benign Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Larp7 A T 3: 127,540,578 N533K probably damaging Het
Lrit3 T C 3: 129,791,246 T288A probably benign Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Lrp1b T C 2: 40,860,661 S2964G probably damaging Het
Lrrc66 C T 5: 73,607,622 V693M probably damaging Het
Macf1 T A 4: 123,471,165 M3268L probably benign Het
Mad1l1 A G 5: 140,303,688 S161P possibly damaging Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Morc3 A G 16: 93,870,497 T588A probably damaging Het
Mospd3 A G 5: 137,600,415 S21P probably damaging Het
Mrpl57 T A 14: 57,826,729 F71L probably damaging Het
Mtbp T C 15: 55,606,715 L594S probably damaging Het
Mthfd2 T C 6: 83,306,731 N323S probably damaging Het
Muc5b G T 7: 141,864,105 S3596I possibly damaging Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncoa1 A T 12: 4,339,049 D75E possibly damaging Het
Ncor1 A C 11: 62,338,158 I958S probably damaging Het
Nefm T C 14: 68,124,114 S234G probably benign Het
Nlrp4c T C 7: 6,065,819 S240P probably damaging Het
Nox3 C T 17: 3,670,017 V298M probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Nudt13 C G 14: 20,310,641 T174R probably damaging Het
Olfr1002 T C 2: 85,647,857 S155G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr1245 A T 2: 89,575,603 L41Q possibly damaging Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr355 T C 2: 36,927,185 I310V probably benign Het
Olfr430 T C 1: 174,070,126 V276A probably damaging Het
Olfr437 T A 6: 43,167,723 probably null Het
Olfr812 G T 10: 129,842,506 P179T probably benign Het
Olfr967 T C 9: 39,750,806 V140A probably benign Het
Opn1sw T A 6: 29,379,804 N144Y possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Parp14 C T 16: 35,853,518 probably null Het
Pde3a C A 6: 141,498,770 N1101K probably benign Het
Plcb1 G A 2: 134,813,613 V38I possibly damaging Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Ppfibp2 C T 7: 107,746,378 P869L probably damaging Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Pramel5 G A 4: 144,273,863 Q48* probably null Het
Prr13 C A 15: 102,460,698 probably benign Het
Psg22 T A 7: 18,724,438 Y312* probably null Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
Rasa4 A G 5: 136,091,238 D56G probably benign Het
Rif1 T A 2: 52,116,673 N2206K possibly damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Sh3pxd2b T C 11: 32,423,559 *909Q probably null Het
Slc25a45 A G 19: 5,884,522 R173G probably damaging Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Smoc1 T C 12: 81,104,671 I54T probably benign Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Steap3 T G 1: 120,241,734 I240L probably benign Het
Stmn4 C T 14: 66,355,609 L13F probably damaging Het
Syt3 T C 7: 44,390,516 S58P possibly damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tbc1d19 T A 5: 53,829,353 C35S probably benign Het
Tcaf3 T C 6: 42,593,552 E422G possibly damaging Het
Tekt4 T A 17: 25,471,858 F46Y possibly damaging Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Tyro3 T C 2: 119,801,695 I81T possibly damaging Het
Upp2 T G 2: 58,771,452 M71R probably damaging Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vcl T A 14: 20,982,699 L122Q probably damaging Het
Vmn1r213 A C 13: 23,012,306 N353T possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp869 T C 8: 69,707,438 K162E probably benign Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9768927 missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9798187 missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9809130 missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9769410 missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9808504 missense probably benign
R7974:Stxbp5 UTSW 10 9770695 splice site probably null
R8009:Stxbp5 UTSW 10 9816302 missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9784385 missense probably benign
R8353:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9812259 critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9809048 missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9812289 missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9817306 missense probably null 0.98
R8805:Stxbp5 UTSW 10 9838115 nonsense probably null
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9900545 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GCCCCAATTACCACCATTGATG -3'
(R):5'- AAACGCTTCACTGTTTTCACAC -3'

Sequencing Primer
(F):5'- GGTCTATTAGGAAGTTATGAACACAG -3'
(R):5'- ACGCTTCACTGTTTTCACACATTTAC -3'
Posted On2014-06-30