Incidental Mutation 'R1902:Ppp1r12a'
ID212363
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12A
Synonyms1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e
MMRRC Submission 039922-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1902 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location108162193-108284475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108198891 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 99 (I99N)
Ref Sequence ENSEMBL: ENSMUSP00000151842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263]
Predicted Effect probably damaging
Transcript: ENSMUST00000070663
AA Change: I99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: I99N

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219263
AA Change: I99N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,534,003 Q355* probably null Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adra1a T C 14: 66,638,235 S220P probably benign Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap45 C A 10: 80,025,466 Q488K probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atxn7l3b A G 10: 112,928,673 I17T probably benign Het
BC003331 T A 1: 150,388,609 probably null Het
Bpifb9a A T 2: 154,261,991 N118I probably benign Het
Btbd9 A T 17: 30,530,228 D37E probably damaging Het
C8a T C 4: 104,856,601 probably null Het
Capn13 G A 17: 73,326,361 S535F probably damaging Het
Carns1 G T 19: 4,166,338 P615Q probably damaging Het
Casz1 T C 4: 148,936,195 I479T possibly damaging Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Cdc42bpb T G 12: 111,326,016 S362R probably damaging Het
Ceacam11 A T 7: 17,975,327 H150L probably benign Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Cpeb1 T C 7: 81,372,119 D92G probably benign Het
Cped1 T A 6: 22,120,981 probably null Het
Csf1r A G 18: 61,130,141 T896A probably damaging Het
Csf3r T C 4: 126,042,918 F658S probably damaging Het
Cts6 A T 13: 61,201,515 Y126* probably null Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Cxcl5 T C 5: 90,759,785 V72A probably damaging Het
Cyp4v3 T A 8: 45,306,952 H521L probably benign Het
Dct T C 14: 118,034,278 N380S probably benign Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnaic1 A T 4: 41,625,319 K428* probably null Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
E2f8 T C 7: 48,871,172 H467R probably benign Het
Eddm3b T A 14: 51,116,864 I103N probably damaging Het
Fam71b A T 11: 46,407,011 T381S probably benign Het
Gal3st2c T G 1: 94,008,889 N185K probably damaging Het
Ganc T C 2: 120,446,482 L675P probably damaging Het
Gdf9 G A 11: 53,436,953 M245I probably benign Het
Gm21886 G A 18: 80,089,418 T175I probably damaging Het
Gria2 A G 3: 80,722,108 L269P probably damaging Het
Grm8 T C 6: 27,429,482 Y471C probably damaging Het
Gucy2g T A 19: 55,210,237 T825S probably benign Het
H2-Bl A T 17: 36,083,953 M16K probably damaging Het
Iffo2 T C 4: 139,607,701 S124P probably damaging Het
Igf1r T C 7: 68,201,249 Y931H possibly damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itgb4 T C 11: 115,980,738 V179A probably damaging Het
Itpr2 T A 6: 146,229,703 H1968L probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif13a A T 13: 46,788,162 D946E probably benign Het
Klhl22 T A 16: 17,771,787 I104N probably damaging Het
Klk6 A C 7: 43,826,057 M1L probably benign Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Larp7 A T 3: 127,540,578 N533K probably damaging Het
Lrit3 T C 3: 129,791,246 T288A probably benign Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Lrp1b T C 2: 40,860,661 S2964G probably damaging Het
Lrrc66 C T 5: 73,607,622 V693M probably damaging Het
Macf1 T A 4: 123,471,165 M3268L probably benign Het
Mad1l1 A G 5: 140,303,688 S161P possibly damaging Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Morc3 A G 16: 93,870,497 T588A probably damaging Het
Mospd3 A G 5: 137,600,415 S21P probably damaging Het
Mrpl57 T A 14: 57,826,729 F71L probably damaging Het
Mtbp T C 15: 55,606,715 L594S probably damaging Het
Mthfd2 T C 6: 83,306,731 N323S probably damaging Het
Muc5b G T 7: 141,864,105 S3596I possibly damaging Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncoa1 A T 12: 4,339,049 D75E possibly damaging Het
Ncor1 A C 11: 62,338,158 I958S probably damaging Het
Nefm T C 14: 68,124,114 S234G probably benign Het
Nlrp4c T C 7: 6,065,819 S240P probably damaging Het
Nox3 C T 17: 3,670,017 V298M probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Nudt13 C G 14: 20,310,641 T174R probably damaging Het
Olfr1002 T C 2: 85,647,857 S155G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr1245 A T 2: 89,575,603 L41Q possibly damaging Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr355 T C 2: 36,927,185 I310V probably benign Het
Olfr430 T C 1: 174,070,126 V276A probably damaging Het
Olfr437 T A 6: 43,167,723 probably null Het
Olfr812 G T 10: 129,842,506 P179T probably benign Het
Olfr967 T C 9: 39,750,806 V140A probably benign Het
Opn1sw T A 6: 29,379,804 N144Y possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Parp14 C T 16: 35,853,518 probably null Het
Pde3a C A 6: 141,498,770 N1101K probably benign Het
Plcb1 G A 2: 134,813,613 V38I possibly damaging Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Ppfibp2 C T 7: 107,746,378 P869L probably damaging Het
Pramel5 G A 4: 144,273,863 Q48* probably null Het
Prr13 C A 15: 102,460,698 probably benign Het
Psg22 T A 7: 18,724,438 Y312* probably null Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
Rasa4 A G 5: 136,091,238 D56G probably benign Het
Rif1 T A 2: 52,116,673 N2206K possibly damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Sh3pxd2b T C 11: 32,423,559 *909Q probably null Het
Slc25a45 A G 19: 5,884,522 R173G probably damaging Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Smoc1 T C 12: 81,104,671 I54T probably benign Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Steap3 T G 1: 120,241,734 I240L probably benign Het
Stmn4 C T 14: 66,355,609 L13F probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt3 T C 7: 44,390,516 S58P possibly damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tbc1d19 T A 5: 53,829,353 C35S probably benign Het
Tcaf3 T C 6: 42,593,552 E422G possibly damaging Het
Tekt4 T A 17: 25,471,858 F46Y possibly damaging Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Tyro3 T C 2: 119,801,695 I81T possibly damaging Het
Upp2 T G 2: 58,771,452 M71R probably damaging Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vcl T A 14: 20,982,699 L122Q probably damaging Het
Vmn1r213 A C 13: 23,012,306 N353T possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp869 T C 8: 69,707,438 K162E probably benign Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108198848 missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108230473 missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108240821 missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108234021 missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108269324 missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108198918 missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108261254 missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108261245 missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108253332 missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108273381 intron probably benign
R0826:Ppp1r12a UTSW 10 108230553 missense possibly damaging 0.46
R0839:Ppp1r12a UTSW 10 108198861 missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108262351 missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108260867 missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108249565 missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108262431 missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108264734 missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108253501 intron probably benign
R3973:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108249478 missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108230590 missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108267402 critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108261025 missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108261216 intron probably null
R5428:Ppp1r12a UTSW 10 108253347 missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108240112 missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108249627 missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108240184 splice site probably null
R6274:Ppp1r12a UTSW 10 108260890 missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108262420 missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108230534 missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108261276 missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108262381 nonsense probably null
R6993:Ppp1r12a UTSW 10 108240837 missense probably benign 0.18
R7565:Ppp1r12a UTSW 10 108268640 missense probably benign 0.21
X0027:Ppp1r12a UTSW 10 108214423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGGCTGCACAATCATG -3'
(R):5'- CAGTGAGCAATTCAGTATCTGTG -3'

Sequencing Primer
(F):5'- CACAATCATGATTGCTACAGATTA -3'
(R):5'- AGAACTCAGAGATTCATCTGCCTCTG -3'
Posted On2014-06-30