Incidental Mutation 'R0124:Scara3'
ID21239
Institutional Source Beutler Lab
Gene Symbol Scara3
Ensembl Gene ENSMUSG00000034463
Gene Namescavenger receptor class A, member 3
SynonymsC130058N24Rik
MMRRC Submission 038409-MU
Accession Numbers

Genbank: NM_172604; MGI: 2444418

Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location65919394-65953935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65931221 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 316 (S316T)
Ref Sequence ENSEMBL: ENSMUSP00000046525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042046]
Predicted Effect probably benign
Transcript: ENSMUST00000042046
AA Change: S316T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046525
Gene: ENSMUSG00000034463
AA Change: S316T

DomainStartEndE-ValueType
transmembrane domain 55 77 N/A INTRINSIC
coiled coil region 117 155 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Collagen 455 513 3.1e-12 PFAM
Pfam:Collagen 499 558 4.2e-11 PFAM
Pfam:Collagen 544 606 2.9e-12 PFAM
Meta Mutation Damage Score 0.4044 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a macrophage scavenger receptor-like protein. This protein has been shown to deplete reactive oxygen species, and thus play an important role in protecting cells from oxidative stress. The expression of this gene is induced by oxidative stress. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Scara3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Scara3 APN 14 65933121 missense probably benign 0.01
IGL00646:Scara3 APN 14 65921156 nonsense probably null
IGL00718:Scara3 APN 14 65931427 missense possibly damaging 0.67
IGL01948:Scara3 APN 14 65930812 missense probably damaging 0.99
IGL01979:Scara3 APN 14 65930963 missense probably benign 0.01
IGL02399:Scara3 APN 14 65933110 nonsense probably null
IGL02939:Scara3 APN 14 65931656 missense probably benign 0.00
IGL02945:Scara3 APN 14 65931211 missense probably damaging 1.00
IGL03075:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03100:Scara3 APN 14 65931273 missense probably damaging 1.00
IGL03156:Scara3 APN 14 65931154 missense probably damaging 1.00
IGL03179:Scara3 APN 14 65931154 missense probably damaging 1.00
condor UTSW 14 65931202 missense probably damaging 1.00
PIT4362001:Scara3 UTSW 14 65936402 missense probably benign
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0062:Scara3 UTSW 14 65930968 missense probably damaging 1.00
R0349:Scara3 UTSW 14 65931781 missense probably damaging 0.98
R1584:Scara3 UTSW 14 65921104 missense probably damaging 1.00
R4785:Scara3 UTSW 14 65953501 start codon destroyed probably null 0.06
R5336:Scara3 UTSW 14 65931038 missense probably damaging 1.00
R6307:Scara3 UTSW 14 65938261 missense probably benign 0.24
R6420:Scara3 UTSW 14 65938252 missense possibly damaging 0.92
R6610:Scara3 UTSW 14 65931221 missense probably damaging 0.97
R7159:Scara3 UTSW 14 65920780 missense probably damaging 0.98
R7208:Scara3 UTSW 14 65931266 missense possibly damaging 0.62
R7246:Scara3 UTSW 14 65931644 missense probably damaging 0.97
R7315:Scara3 UTSW 14 65931440 missense probably damaging 1.00
R7324:Scara3 UTSW 14 65931416 missense probably benign 0.03
R7497:Scara3 UTSW 14 65931202 missense probably damaging 1.00
R7504:Scara3 UTSW 14 65931331 missense possibly damaging 0.82
R7554:Scara3 UTSW 14 65920850 missense possibly damaging 0.69
R8143:Scara3 UTSW 14 65931820 missense probably damaging 0.96
YA93:Scara3 UTSW 14 65930949 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATTGAAGTCTAACCGGGCACTGAG -3'
(R):5'- GTCACTGACTGGCAGAACTACACC -3'

Sequencing Primer
(F):5'- ACGGATTTATTCAGGTAGTAGAGC -3'
(R):5'- GAACTACACCAGACTCTTTGGG -3'
Posted On2013-04-11