Mutagenetix > Incidental Mutations

Incidental Mutation 'R0124:Matn2'

21241

Institutional Source

Beutler Lab

Gene Symbol

Matn2

Ensembl Gene

ENSMUSG00000022324

Gene Name

matrilin 2

Synonyms

Crtm2

MMRRC Submission

038409-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0124 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

34306677-34436273 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 34426151 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154572 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022947] [ENSMUST00000163455] [ENSMUST00000227759] [ENSMUST00000228570]

Predicted Effect

probably benign
Transcript: ENSMUST00000022947

SMART Domains

Protein: ENSMUSP00000022947
Gene: ENSMUSG00000022324

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	889	935	4.78e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000163455

SMART Domains

Protein: ENSMUSP00000128202
Gene: ENSMUSG00000022324

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
VWA	55	237	1.99e-49	SMART
EGF	241	278	6.86e-4	SMART
EGF	282	319	5.49e-3	SMART
EGF	323	360	7.88e-4	SMART
EGF	364	401	6.76e-3	SMART
EGF	405	442	4.39e-2	SMART
EGF	446	483	9.41e-2	SMART
EGF	487	524	1.24e-1	SMART
EGF	528	565	2.23e-3	SMART
EGF	569	606	8.44e-4	SMART
EGF	610	647	9.55e-3	SMART
VWA	653	831	1.14e-49	SMART
Matrilin_ccoil	908	955	7.77e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227759

Predicted Effect

probably benign
Transcript: ENSMUST00000228570

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.3%
10x: 95.7%
20x: 89.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the von Willebrand factor A domain containing protein family. This family of proteins is thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This protein contains five von Willebrand factor A domains. The specific function of this gene has not yet been determined. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,161,674	T194A	probably benign	Het
Afap1	C	T	5: 35,945,209	P82S	probably damaging	Het
Ankrd28	A	G	14: 31,727,741	Y481H	probably damaging	Het
Arid1b	C	T	17: 5,339,330	T1717I	probably damaging	Het
Atad2b	A	G	12: 4,952,676	K348R	probably benign	Het
B020004J07Rik	A	G	4: 101,835,373	*477Q	probably null	Het
Bcl3	C	T	7: 19,809,651	V5M	probably damaging	Het
C2cd3	A	G	7: 100,469,518	E2321G	probably benign	Het
Casq1	C	T	1: 172,210,425	V380M	probably damaging	Het
Cd209e	T	A	8: 3,851,274	T127S	probably benign	Het
Cdh23	G	T	10: 60,308,056	Y2921*	probably null	Het
Cdh6	A	G	15: 13,034,324	L750P	probably damaging	Het
Cdk12	T	C	11: 98,211,247		probably benign	Het
Ces5a	T	C	8: 93,528,555	E170G	probably damaging	Het
Clec4f	A	G	6: 83,652,353		probably null	Het
Col19a1	T	C	1: 24,526,458	N264S	unknown	Het
Col2a1	T	A	15: 97,998,862	I43F	unknown	Het
Col4a2	A	G	8: 11,408,871		probably benign	Het
Csmd3	T	A	15: 47,590,716	D3578V	probably damaging	Het
Cyp2c37	T	C	19: 39,994,102	L128P	probably damaging	Het
Dysf	A	G	6: 84,065,102		probably benign	Het
Eml1	T	C	12: 108,506,608	V225A	probably benign	Het
Eml1	A	G	12: 108,509,178	Y256C	probably damaging	Het
Epb41l5	T	A	1: 119,633,640	K64*	probably null	Het
Fat2	A	G	11: 55,283,678	F2070L	probably damaging	Het
Fbxw18	G	T	9: 109,691,515	H259N	probably benign	Het
Gm10764	A	T	10: 87,290,748	T6S	unknown	Het
Gm14412	A	G	2: 177,315,912		probably benign	Het
Heatr5b	A	T	17: 78,826,217		probably benign	Het
Hid1	T	C	11: 115,356,823	T250A	probably damaging	Het
Hnf4g	A	G	3: 3,643,082		probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Lrriq1	C	T	10: 103,170,420		probably null	Het
Map3k13	A	G	16: 21,903,756	T223A	possibly damaging	Het
Myo6	A	G	9: 80,307,774	E1253G	probably damaging	Het
Nomo1	G	T	7: 46,083,228		probably benign	Het
Olfr1221	A	T	2: 89,111,744	I256K	possibly damaging	Het
Olfr160	A	G	9: 37,711,463	V272A	possibly damaging	Het
Olfr356	A	T	2: 36,937,256	I46F	possibly damaging	Het
Papolg	C	T	11: 23,867,535	A582T	probably benign	Het
Plekhm3	C	T	1: 64,921,751	E449K	probably damaging	Het
Pole	T	G	5: 110,303,992	M900R	probably damaging	Het
Ppp1cb	T	A	5: 32,483,478		probably benign	Het
Pros1	A	G	16: 62,913,946	T372A	possibly damaging	Het
Scara3	A	T	14: 65,931,221	S316T	probably benign	Het
St5	A	G	7: 109,542,511	S132P	possibly damaging	Het
Stau2	C	T	1: 16,463,128	A61T	probably damaging	Het
Stx3	T	C	19: 11,791,799	E54G	possibly damaging	Het
Sun1	T	C	5: 139,246,679		probably benign	Het
Swt1	A	T	1: 151,391,529	C634S	probably damaging	Het
Syt6	A	G	3: 103,587,526	Y269C	probably damaging	Het
Tfap2a	G	A	13: 40,717,411		probably benign	Het
Tmx4	A	T	2: 134,639,720		probably null	Het
Ttc39d	T	C	17: 80,216,946	C345R	probably damaging	Het
Vmn1r27	T	C	6: 58,215,248	Y257C	probably damaging	Het
Vmn2r27	T	A	6: 124,231,619	T56S	probably benign	Het
Vps13b	T	C	15: 35,576,528		probably null	Het
Wdr17	A	G	8: 54,635,491	S1175P	probably damaging	Het
Wsb2	T	C	5: 117,363,758	F63L	probably benign	Het
Zfp142	A	G	1: 74,568,623	Y1561H	probably damaging	Het

Other mutations in Matn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Matn2	APN	15	34428470	missense	probably damaging	1.00
IGL00392:Matn2	APN	15	34402856	missense	probably benign	0.00
IGL01475:Matn2	APN	15	34316525	missense	possibly damaging	0.94
IGL02223:Matn2	APN	15	34423718	missense	probably benign	0.00
IGL02252:Matn2	APN	15	34316590	missense	probably damaging	0.98
IGL02288:Matn2	APN	15	34422386	missense	probably damaging	1.00
IGL02738:Matn2	APN	15	34388739	missense	probably benign	0.07
IGL02927:Matn2	APN	15	34355655	missense	probably damaging	1.00
IGL03331:Matn2	APN	15	34345357	missense	probably damaging	1.00
Engorged	UTSW	15	34426234	missense	probably damaging	1.00
PIT4260001:Matn2	UTSW	15	34428731	missense	possibly damaging	0.78
R0422:Matn2	UTSW	15	34435771	splice site	probably null
R0449:Matn2	UTSW	15	34428541	missense	probably damaging	1.00
R0606:Matn2	UTSW	15	34345150	missense	probably damaging	1.00
R0655:Matn2	UTSW	15	34345200	missense	probably benign	0.03
R0885:Matn2	UTSW	15	34316605	missense	possibly damaging	0.67
R1384:Matn2	UTSW	15	34409810	missense	probably benign	0.00
R1603:Matn2	UTSW	15	34388768	missense	probably damaging	1.00
R1667:Matn2	UTSW	15	34378732	missense	probably damaging	0.99
R1720:Matn2	UTSW	15	34345274	nonsense	probably null
R1772:Matn2	UTSW	15	34428785	missense	probably damaging	0.99
R2037:Matn2	UTSW	15	34433117	missense	probably benign	0.00
R2107:Matn2	UTSW	15	34423759	missense	probably damaging	1.00
R2240:Matn2	UTSW	15	34433063	missense	probably damaging	1.00
R3933:Matn2	UTSW	15	34345420	splice site	probably null
R3963:Matn2	UTSW	15	34388791	nonsense	probably null
R4648:Matn2	UTSW	15	34428533	missense	probably damaging	1.00
R4695:Matn2	UTSW	15	34402925	missense	probably damaging	1.00
R4817:Matn2	UTSW	15	34423799	missense	probably damaging	1.00
R4935:Matn2	UTSW	15	34428685	missense	probably damaging	1.00
R5105:Matn2	UTSW	15	34355668	missense	possibly damaging	0.95
R5177:Matn2	UTSW	15	34433514	missense	possibly damaging	0.58
R5717:Matn2	UTSW	15	34399091	nonsense	probably null
R5760:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R5776:Matn2	UTSW	15	34431619	missense	probably damaging	1.00
R5842:Matn2	UTSW	15	34399056	missense	probably damaging	0.99
R5917:Matn2	UTSW	15	34409766	nonsense	probably null
R5964:Matn2	UTSW	15	34410165	missense	probably damaging	1.00
R6265:Matn2	UTSW	15	34399155	missense	probably damaging	1.00
R6272:Matn2	UTSW	15	34355607	missense	possibly damaging	0.46
R6332:Matn2	UTSW	15	34423755	missense	probably benign	0.00
R6457:Matn2	UTSW	15	34426234	missense	probably damaging	1.00
R7351:Matn2	UTSW	15	34345336	missense	probably damaging	0.97
R7660:Matn2	UTSW	15	34402946	missense	probably benign	0.00
R7660:Matn2	UTSW	15	34423728	nonsense	probably null
R7775:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R7778:Matn2	UTSW	15	34399077	missense	possibly damaging	0.94
R8007:Matn2	UTSW	15	34426169	missense	probably benign	0.01
R8059:Matn2	UTSW	15	34345335	missense	probably damaging	1.00
R8174:Matn2	UTSW	15	34422409	missense	probably benign	0.30
R8331:Matn2	UTSW	15	34428681	missense	probably damaging	1.00
R8354:Matn2	UTSW	15	34378697	missense	probably damaging	0.98
R8377:Matn2	UTSW	15	34345365	missense	probably damaging	1.00
R8393:Matn2	UTSW	15	34355602	missense	possibly damaging	0.92
R8532:Matn2	UTSW	15	34316553	missense	probably benign	0.42
R8555:Matn2	UTSW	15	34423805	missense	probably benign	0.03
R8756:Matn2	UTSW	15	34423730	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TGGCAAATCCACCAGGTCCAGTAG -3'
(R):5'- ACTAAATCAAAGGTGTTCTGGCGGC -3'

Sequencing Primer
(F):5'- CCAGGTCCAGTAGGGTCAAAAG -3'
(R):5'- GTCCGCATATACATCTATGGCAG -3'

Posted On

2013-04-11