Incidental Mutation 'R1902:Dsc1'
ID212415
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 039922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1902 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20095988 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 415 (V415D)
Ref Sequence ENSEMBL: ENSMUSP00000153639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect probably damaging
Transcript: ENSMUST00000038710
AA Change: V415D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: V415D

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224432
AA Change: V415D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,534,003 Q355* probably null Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adra1a T C 14: 66,638,235 S220P probably benign Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap45 C A 10: 80,025,466 Q488K probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atxn7l3b A G 10: 112,928,673 I17T probably benign Het
BC003331 T A 1: 150,388,609 probably null Het
Bpifb9a A T 2: 154,261,991 N118I probably benign Het
Btbd9 A T 17: 30,530,228 D37E probably damaging Het
C8a T C 4: 104,856,601 probably null Het
Capn13 G A 17: 73,326,361 S535F probably damaging Het
Carns1 G T 19: 4,166,338 P615Q probably damaging Het
Casz1 T C 4: 148,936,195 I479T possibly damaging Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Cdc42bpb T G 12: 111,326,016 S362R probably damaging Het
Ceacam11 A T 7: 17,975,327 H150L probably benign Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Cpeb1 T C 7: 81,372,119 D92G probably benign Het
Cped1 T A 6: 22,120,981 probably null Het
Csf1r A G 18: 61,130,141 T896A probably damaging Het
Csf3r T C 4: 126,042,918 F658S probably damaging Het
Cts6 A T 13: 61,201,515 Y126* probably null Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Cxcl5 T C 5: 90,759,785 V72A probably damaging Het
Cyp4v3 T A 8: 45,306,952 H521L probably benign Het
Dct T C 14: 118,034,278 N380S probably benign Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnaic1 A T 4: 41,625,319 K428* probably null Het
E2f8 T C 7: 48,871,172 H467R probably benign Het
Eddm3b T A 14: 51,116,864 I103N probably damaging Het
Fam71b A T 11: 46,407,011 T381S probably benign Het
Gal3st2c T G 1: 94,008,889 N185K probably damaging Het
Ganc T C 2: 120,446,482 L675P probably damaging Het
Gdf9 G A 11: 53,436,953 M245I probably benign Het
Gm21886 G A 18: 80,089,418 T175I probably damaging Het
Gria2 A G 3: 80,722,108 L269P probably damaging Het
Grm8 T C 6: 27,429,482 Y471C probably damaging Het
Gucy2g T A 19: 55,210,237 T825S probably benign Het
H2-Bl A T 17: 36,083,953 M16K probably damaging Het
Iffo2 T C 4: 139,607,701 S124P probably damaging Het
Igf1r T C 7: 68,201,249 Y931H possibly damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itgb4 T C 11: 115,980,738 V179A probably damaging Het
Itpr2 T A 6: 146,229,703 H1968L probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif13a A T 13: 46,788,162 D946E probably benign Het
Klhl22 T A 16: 17,771,787 I104N probably damaging Het
Klk6 A C 7: 43,826,057 M1L probably benign Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Larp7 A T 3: 127,540,578 N533K probably damaging Het
Lrit3 T C 3: 129,791,246 T288A probably benign Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Lrp1b T C 2: 40,860,661 S2964G probably damaging Het
Lrrc66 C T 5: 73,607,622 V693M probably damaging Het
Macf1 T A 4: 123,471,165 M3268L probably benign Het
Mad1l1 A G 5: 140,303,688 S161P possibly damaging Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Morc3 A G 16: 93,870,497 T588A probably damaging Het
Mospd3 A G 5: 137,600,415 S21P probably damaging Het
Mrpl57 T A 14: 57,826,729 F71L probably damaging Het
Mtbp T C 15: 55,606,715 L594S probably damaging Het
Mthfd2 T C 6: 83,306,731 N323S probably damaging Het
Muc5b G T 7: 141,864,105 S3596I possibly damaging Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncoa1 A T 12: 4,339,049 D75E possibly damaging Het
Ncor1 A C 11: 62,338,158 I958S probably damaging Het
Nefm T C 14: 68,124,114 S234G probably benign Het
Nlrp4c T C 7: 6,065,819 S240P probably damaging Het
Nox3 C T 17: 3,670,017 V298M probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Nudt13 C G 14: 20,310,641 T174R probably damaging Het
Olfr1002 T C 2: 85,647,857 S155G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr1245 A T 2: 89,575,603 L41Q possibly damaging Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr355 T C 2: 36,927,185 I310V probably benign Het
Olfr430 T C 1: 174,070,126 V276A probably damaging Het
Olfr437 T A 6: 43,167,723 probably null Het
Olfr812 G T 10: 129,842,506 P179T probably benign Het
Olfr967 T C 9: 39,750,806 V140A probably benign Het
Opn1sw T A 6: 29,379,804 N144Y possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Parp14 C T 16: 35,853,518 probably null Het
Pde3a C A 6: 141,498,770 N1101K probably benign Het
Plcb1 G A 2: 134,813,613 V38I possibly damaging Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Ppfibp2 C T 7: 107,746,378 P869L probably damaging Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Pramel5 G A 4: 144,273,863 Q48* probably null Het
Prr13 C A 15: 102,460,698 probably benign Het
Psg22 T A 7: 18,724,438 Y312* probably null Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
Rasa4 A G 5: 136,091,238 D56G probably benign Het
Rif1 T A 2: 52,116,673 N2206K possibly damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Sh3pxd2b T C 11: 32,423,559 *909Q probably null Het
Slc25a45 A G 19: 5,884,522 R173G probably damaging Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Smoc1 T C 12: 81,104,671 I54T probably benign Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Steap3 T G 1: 120,241,734 I240L probably benign Het
Stmn4 C T 14: 66,355,609 L13F probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt3 T C 7: 44,390,516 S58P possibly damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tbc1d19 T A 5: 53,829,353 C35S probably benign Het
Tcaf3 T C 6: 42,593,552 E422G possibly damaging Het
Tekt4 T A 17: 25,471,858 F46Y possibly damaging Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Tyro3 T C 2: 119,801,695 I81T possibly damaging Het
Upp2 T G 2: 58,771,452 M71R probably damaging Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vcl T A 14: 20,982,699 L122Q probably damaging Het
Vmn1r213 A C 13: 23,012,306 N353T possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp869 T C 8: 69,707,438 K162E probably benign Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCACTACTATGGTGTGTG -3'
(R):5'- AAAGGCATTTCTTCCCTCAGTATAC -3'

Sequencing Primer
(F):5'- TTATGACACATCAACTGGCTACAAC -3'
(R):5'- TTCTTCCCTCAGTATACTACAGAAG -3'
Posted On2014-06-30