Incidental Mutation 'R0034:Aplp1'
ID212430
Institutional Source Beutler Lab
Gene Symbol Aplp1
Ensembl Gene ENSMUSG00000006651
Gene Nameamyloid beta (A4) precursor-like protein 1
Synonyms
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0034 (G1)
Quality Score48
Status Validated
Chromosome7
Chromosomal Location30434982-30445535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30444442 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 56 (V56G)
Ref Sequence ENSEMBL: ENSMUSP00000006828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006828] [ENSMUST00000045817]
Predicted Effect probably damaging
Transcript: ENSMUST00000006828
AA Change: V56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006828
Gene: ENSMUSG00000006651
AA Change: V56G

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
A4_EXTRA 46 211 1.72e-114 SMART
low complexity region 234 247 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
Pfam:APP_E2 289 471 9.3e-72 PFAM
Pfam:APP_amyloid 600 651 9.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045817
SMART Domains Protein: ENSMUSP00000039395
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG 128 219 5.13e-1 SMART
IG_like 230 306 8.06e0 SMART
IGc2 321 379 3.06e-8 SMART
IG_like 401 500 4.65e1 SMART
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 607 629 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140565
Predicted Effect probably benign
Transcript: ENSMUST00000170152
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209054
Meta Mutation Damage Score 0.8314 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved amyloid precursor protein gene family. The encoded protein is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. This cleavage liberates an intracellular cytoplasmic fragment that may act as a transcriptional activator. The encoded protein may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show a 10% decrease in body weight at 9 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Aplp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Aplp1 APN 7 30444418 missense probably damaging 0.97
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R0021:Aplp1 UTSW 7 30435816 splice site probably benign
R1480:Aplp1 UTSW 7 30436023 missense probably benign 0.01
R1538:Aplp1 UTSW 7 30436027 missense probably benign
R2177:Aplp1 UTSW 7 30442521 nonsense probably null
R3017:Aplp1 UTSW 7 30435971 critical splice donor site probably null
R5143:Aplp1 UTSW 7 30441123 missense probably damaging 1.00
R5465:Aplp1 UTSW 7 30436852 missense probably benign
R5482:Aplp1 UTSW 7 30440175 missense probably damaging 1.00
R5530:Aplp1 UTSW 7 30436829 missense possibly damaging 0.70
R6112:Aplp1 UTSW 7 30435477 missense probably damaging 1.00
R6721:Aplp1 UTSW 7 30440295 missense probably null 1.00
R6931:Aplp1 UTSW 7 30443200 missense probably damaging 1.00
R7314:Aplp1 UTSW 7 30435989 missense probably damaging 0.98
R7707:Aplp1 UTSW 7 30443098 missense probably damaging 1.00
R7980:Aplp1 UTSW 7 30435567 missense probably benign 0.44
R8005:Aplp1 UTSW 7 30436045 critical splice acceptor site probably null
R8126:Aplp1 UTSW 7 30441739 missense probably damaging 1.00
Z1177:Aplp1 UTSW 7 30438189 missense probably benign 0.44
Z1177:Aplp1 UTSW 7 30438279 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGACTCTGCCAAGTCCAGCTTCC -3'
(R):5'- TGTCTTCTCAGCAACAAGGCCG -3'

Sequencing Primer
(F):5'- CAAGTCCAGCTTCCTCAAGG -3'
(R):5'- CAGGTCACCATAGCAACGGG -3'
Posted On2014-07-02