Incidental Mutation 'R0034:Kif26a'
ID212438
Institutional Source Beutler Lab
Gene Symbol Kif26a
Ensembl Gene ENSMUSG00000021294
Gene Namekinesin family member 26A
SynonymsN-11 kinesin
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.863) question?
Stock #R0034 (G1)
Quality Score63
Status Validated
Chromosome12
Chromosomal Location112146208-112181747 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 112168963 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128402]
Predicted Effect probably benign
Transcript: ENSMUST00000128402
SMART Domains Protein: ENSMUSP00000119482
Gene: ENSMUSG00000021294

DomainStartEndE-ValueType
low complexity region 238 248 N/A INTRINSIC
low complexity region 279 297 N/A INTRINSIC
KISc 362 726 9.57e-35 SMART
low complexity region 727 739 N/A INTRINSIC
low complexity region 740 754 N/A INTRINSIC
low complexity region 932 957 N/A INTRINSIC
low complexity region 1005 1012 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1328 1360 N/A INTRINSIC
low complexity region 1458 1471 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1519 1538 N/A INTRINSIC
low complexity region 1574 1587 N/A INTRINSIC
low complexity region 1664 1675 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
coiled coil region 1780 1812 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death associated with megacolon and hyperganglionosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pcdhb5 A G 18: 37,322,084 N506D probably damaging Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Kif26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Kif26a APN 12 112157632 missense probably damaging 0.97
IGL01734:Kif26a APN 12 112176828 missense probably benign 0.23
IGL01916:Kif26a APN 12 112176894 missense possibly damaging 0.49
IGL02080:Kif26a APN 12 112157566 missense probably damaging 1.00
IGL02138:Kif26a APN 12 112174850 missense probably damaging 1.00
IGL02145:Kif26a APN 12 112176975 missense probably benign 0.00
IGL02285:Kif26a APN 12 112157507 missense probably damaging 1.00
IGL02393:Kif26a APN 12 112172664 missense probably damaging 1.00
IGL02445:Kif26a APN 12 112173743 missense probably damaging 1.00
IGL02865:Kif26a APN 12 112177615 nonsense probably null
IGL03057:Kif26a APN 12 112175774 nonsense probably null
IGL03204:Kif26a APN 12 112174779 missense probably damaging 1.00
R0013:Kif26a UTSW 12 112177880 missense probably benign 0.03
R0089:Kif26a UTSW 12 112177403 missense probably damaging 0.98
R0111:Kif26a UTSW 12 112163337 splice site probably benign
R0220:Kif26a UTSW 12 112157390 missense probably damaging 0.98
R0346:Kif26a UTSW 12 112179348 missense probably null 0.09
R0383:Kif26a UTSW 12 112178076 missense possibly damaging 0.94
R0478:Kif26a UTSW 12 112175789 missense probably damaging 1.00
R0494:Kif26a UTSW 12 112179471 splice site probably null
R1163:Kif26a UTSW 12 112179945 missense probably benign 0.08
R1450:Kif26a UTSW 12 112173852 missense probably damaging 1.00
R1512:Kif26a UTSW 12 112146955 missense possibly damaging 0.47
R1616:Kif26a UTSW 12 112157246 critical splice acceptor site probably null
R1723:Kif26a UTSW 12 112173858 missense possibly damaging 0.67
R1728:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1729:Kif26a UTSW 12 112176785 missense possibly damaging 0.95
R1903:Kif26a UTSW 12 112175540 missense probably damaging 1.00
R2283:Kif26a UTSW 12 112177353 missense possibly damaging 0.66
R3862:Kif26a UTSW 12 112179889 missense probably benign 0.30
R3906:Kif26a UTSW 12 112176890 missense probably benign
R4050:Kif26a UTSW 12 112179916 missense probably benign 0.08
R4270:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4271:Kif26a UTSW 12 112173414 missense probably damaging 1.00
R4731:Kif26a UTSW 12 112175573 missense probably benign
R4732:Kif26a UTSW 12 112175573 missense probably benign
R4733:Kif26a UTSW 12 112175573 missense probably benign
R4908:Kif26a UTSW 12 112157342 missense probably damaging 1.00
R4946:Kif26a UTSW 12 112177794 missense probably damaging 0.99
R5566:Kif26a UTSW 12 112157354 missense probably damaging 1.00
R6280:Kif26a UTSW 12 112174869 missense probably damaging 0.99
R6422:Kif26a UTSW 12 112168875 missense possibly damaging 0.95
R6513:Kif26a UTSW 12 112175492 missense probably damaging 0.97
R6860:Kif26a UTSW 12 112146829 missense probably damaging 1.00
R6879:Kif26a UTSW 12 112177653 missense probably benign
R7127:Kif26a UTSW 12 112178145 missense probably damaging 1.00
R7366:Kif26a UTSW 12 112163542 critical splice donor site probably null
R7595:Kif26a UTSW 12 112179325 missense probably benign 0.30
R7630:Kif26a UTSW 12 112175697 missense probably damaging 1.00
R7784:Kif26a UTSW 12 112178147 missense possibly damaging 0.66
X0027:Kif26a UTSW 12 112176070 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGTTGGTACACCCTAAGCACCCTC -3'
(R):5'- TTCACCACACGGCTATCCTGGAAC -3'

Sequencing Primer
(F):5'- TGCCCAGAAGCTCAGCC -3'
(R):5'- TGAGGACAAGTTTCTCGTCATC -3'
Posted On2014-07-02