Incidental Mutation 'R0034:Pcdhb5'
ID212442
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 038328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R0034 (G1)
Quality Score47
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37322084 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 506 (N506D)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000078271
AA Change: N506D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: N506D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.4277 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C A 19: 7,420,359 H90Q probably damaging Het
4930402H24Rik T C 2: 130,736,572 H664R probably damaging Het
9430038I01Rik C T 7: 137,387,592 R60Q probably benign Het
Angpt4 C T 2: 151,929,391 T209I probably benign Het
Ap3b1 T C 13: 94,479,885 probably benign Het
Aplp1 A C 7: 30,444,442 V56G probably damaging Het
Asns G A 6: 7,676,299 P419L probably damaging Het
Atxn7 A T 14: 14,100,846 H844L probably damaging Het
Cd14 A G 18: 36,726,235 Y56H probably benign Het
Cd300lb C T 11: 114,928,399 V135I probably damaging Het
Cep152 C T 2: 125,583,893 A851T probably benign Het
Cfap74 C T 4: 155,460,887 probably benign Het
Col28a1 T A 6: 8,175,708 I47L probably benign Het
Eef1d T C 15: 75,902,959 T200A probably benign Het
Faap100 A T 11: 120,372,147 M795K probably benign Het
Gabpb1 C T 2: 126,658,534 R15Q possibly damaging Het
Gata4 C A 14: 63,201,484 M381I probably benign Het
Gm5114 A G 7: 39,408,858 S446P possibly damaging Het
Gm7271 A G 5: 76,516,530 I155M probably damaging Het
Gnb1 T A 4: 155,551,689 N155K probably benign Het
Haspin G A 11: 73,138,218 T15M probably damaging Het
Heatr5a A G 12: 51,925,172 L745P probably damaging Het
Kcng3 T A 17: 83,588,383 probably benign Het
Kif15 A T 9: 122,999,285 N887I possibly damaging Het
Kif26a T C 12: 112,168,963 probably benign Het
Kif9 G A 9: 110,519,611 C738Y probably benign Het
Kifc2 G T 15: 76,667,100 C613F probably benign Het
Klf12 A G 14: 99,987,429 probably null Het
Lrp1 A T 10: 127,545,651 I3826N probably benign Het
Map2k4 A G 11: 65,719,611 probably benign Het
Myo7b A G 18: 31,960,860 S2006P probably damaging Het
Olfr631 T C 7: 103,929,501 V226A probably benign Het
Pax4 T C 6: 28,442,449 T285A probably benign Het
Pkhd1l1 G A 15: 44,504,009 G768S probably benign Het
Plb1 G T 5: 32,273,113 G138V probably benign Het
Poln A C 5: 34,115,418 V398G possibly damaging Het
Poteg A G 8: 27,462,077 probably benign Het
Rapgef1 C A 2: 29,724,768 probably benign Het
Rbm43 A T 2: 51,925,710 D166E probably benign Het
Rhobtb2 T C 14: 69,788,688 T602A probably benign Het
Samd3 G A 10: 26,271,500 probably benign Het
Sbno2 A C 10: 80,058,340 probably benign Het
Sec1 A G 7: 45,679,335 V96A probably benign Het
Senp7 A C 16: 56,153,570 S385R possibly damaging Het
Sgk3 T C 1: 9,885,677 V301A probably damaging Het
Sgpl1 A T 10: 61,102,613 M467K probably damaging Het
Slc22a26 A G 19: 7,802,253 I66T probably benign Het
Stra6 G A 9: 58,151,469 probably null Het
Tfrc T A 16: 32,615,396 probably null Het
Tmem30b T C 12: 73,546,005 Y112C probably damaging Het
Trap1 A T 16: 4,069,030 probably benign Het
Trpc1 A G 9: 95,749,761 S43P probably damaging Het
Tsku T C 7: 98,352,663 T154A possibly damaging Het
Uroc1 T C 6: 90,345,310 V272A probably damaging Het
Vmn1r69 T A 7: 10,580,811 probably benign Het
Vmn2r1 T A 3: 64,090,014 W364R probably damaging Het
Wnk2 G T 13: 49,068,080 T377K possibly damaging Het
Zscan20 T C 4: 128,585,662 N1012S probably damaging Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 splice site probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
R7584:Pcdhb5 UTSW 18 37322372 missense possibly damaging 0.90
R8214:Pcdhb5 UTSW 18 37321583 missense probably benign 0.37
R8327:Pcdhb5 UTSW 18 37320900 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCAGAGCTGAGTACAACATCACC -3'
(R):5'- GTCATTGTCGTCTAGCACCACCAC -3'

Sequencing Primer
(F):5'- AGGTGTCCGACATTAACGAC -3'
(R):5'- GTAGAATTCGAAGCCCTGCA -3'
Posted On2014-07-02