Incidental Mutation 'R0664:Epcam'
ID212447
Institutional Source Beutler Lab
Gene Symbol Epcam
Ensembl Gene ENSMUSG00000045394
Gene Nameepithelial cell adhesion molecule
SynonymsGA733-2, Egp314, EpCAM, gp40, Ly74, EGP-2, CD326, panepithelial glycoprotein 314, TROP1, Ep-CAM, EpCAM1, Tacstd1
MMRRC Submission 038849-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0664 (G1)
Quality Score51
Status Validated
Chromosome17
Chromosomal Location87635979-87651106 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87639970 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 51 (Y51N)
Ref Sequence ENSEMBL: ENSMUSP00000061935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053577
AA Change: Y51N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061935
Gene: ENSMUSG00000045394
AA Change: Y51N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TY 96 139 3.96e-8 SMART
transmembrane domain 267 289 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with decreased embryo size, impaired labyrinth layer development and decreased number of trophoblast giant cells. Mice homozygous for another knock-out allele exhibit impaired intestinal tight junctions with lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Agmo A T 12: 37,252,572 H136L probably damaging Het
B020004C17Rik G A 14: 57,016,768 R116H possibly damaging Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Champ1 G A 8: 13,879,485 V548M probably damaging Het
Dnah7b A T 1: 46,324,842 M3541L probably damaging Het
Emc9 A G 14: 55,581,908 L138P possibly damaging Het
Gpr55 A T 1: 85,941,017 S281T probably benign Het
Grid2ip T A 5: 143,363,977 probably null Het
Hgfac G T 5: 35,048,178 V601F probably benign Het
Hlcs A G 16: 94,231,311 W545R probably damaging Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Jcad A G 18: 4,676,063 D1275G probably damaging Het
Mdn1 G T 4: 32,768,011 E5315* probably null Het
Nfam1 T C 15: 83,014,938 T176A probably damaging Het
Nsd3 T C 8: 25,714,240 F432S probably damaging Het
Olfr1183 C T 2: 88,462,171 P296L probably damaging Het
Prmt5 G T 14: 54,507,856 T618K probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Serpinb7 A G 1: 107,428,307 D20G probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Stk26 T A X: 50,887,926 Y283* probably null Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Thada A G 17: 84,336,829 L1288P probably damaging Het
Ttbk2 C A 2: 120,748,821 V607F probably damaging Het
Other mutations in Epcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02739:Epcam APN 17 87640494 missense probably benign 0.30
R1612:Epcam UTSW 17 87639938 missense possibly damaging 0.87
R1693:Epcam UTSW 17 87639896 missense probably benign
R1719:Epcam UTSW 17 87642128 missense probably damaging 1.00
R1998:Epcam UTSW 17 87640474 missense probably damaging 1.00
R3872:Epcam UTSW 17 87639926 missense possibly damaging 0.79
R4297:Epcam UTSW 17 87640534 splice site probably null
R4298:Epcam UTSW 17 87640534 splice site probably null
R4866:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R4900:Epcam UTSW 17 87643621 missense possibly damaging 0.79
R5091:Epcam UTSW 17 87642152 missense probably damaging 1.00
R5301:Epcam UTSW 17 87636877 missense possibly damaging 0.92
R6207:Epcam UTSW 17 87640436 missense probably damaging 1.00
R7576:Epcam UTSW 17 87640293 missense probably damaging 1.00
R7751:Epcam UTSW 17 87640476 nonsense probably null
R7795:Epcam UTSW 17 87643555 missense probably benign 0.08
R8022:Epcam UTSW 17 87646308 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCAGCATTTCTGGCTCAAGACCAC -3'
(R):5'- GCCATCCAGGCCAAGGATTATTCAC -3'

Sequencing Primer
(F):5'- TGGCTCAAGACCACTTCTTAAAGG -3'
(R):5'- CGAGGAGCCTCGATTTGAAAAG -3'
Posted On2014-07-02