Incidental Mutation 'R0242:Cgnl1'
ID 212449
Institutional Source Beutler Lab
Gene Symbol Cgnl1
Ensembl Gene ENSMUSG00000032232
Gene Name cingulin-like 1
Synonyms 4933421H10Rik, Jacop, 9930020M10Rik
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0242 (G1)
Quality Score 77
Status Validated
Chromosome 9
Chromosomal Location 71533791-71678884 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71628939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 577 (V577A)
Ref Sequence ENSEMBL: ENSMUSP00000113917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072899] [ENSMUST00000121322] [ENSMUST00000122065]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000072899
AA Change: V577A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072672
Gene: ENSMUSG00000032232
AA Change: V577A

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
low complexity region 728 739 N/A INTRINSIC
Pfam:Myosin_tail_1 984 1255 5.4e-30 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121322
AA Change: V577A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113917
Gene: ENSMUSG00000032232
AA Change: V577A

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 638 653 N/A INTRINSIC
Pfam:Myosin_tail_1 909 1184 2.3e-30 PFAM
low complexity region 1187 1207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122065
AA Change: V577A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112479
Gene: ENSMUSG00000032232
AA Change: V577A

DomainStartEndE-ValueType
low complexity region 292 309 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
Pfam:Myosin_tail_1 582 1034 1.3e-12 PFAM
Pfam:Myosin_tail_1 1011 1253 7.7e-38 PFAM
low complexity region 1258 1278 N/A INTRINSIC
Meta Mutation Damage Score 0.1541 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the tight junctions and adherens junctions in vertebrate epithelial cells. The encoded protein regulates the activity of Rho family GTPases during junction assembly and at confluence. At the adherens junctions, the encoded protein is part of a protein complex that links E-cadherin to the microtubule cytoskeleton. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Cgnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cgnl1 APN 9 71,563,338 (GRCm39) missense probably benign 0.00
IGL01128:Cgnl1 APN 9 71,631,843 (GRCm39) missense possibly damaging 0.81
IGL01450:Cgnl1 APN 9 71,539,144 (GRCm39) splice site probably benign
IGL01788:Cgnl1 APN 9 71,562,672 (GRCm39) missense probably benign
IGL01806:Cgnl1 APN 9 71,557,604 (GRCm39) missense probably damaging 0.99
IGL01906:Cgnl1 APN 9 71,631,849 (GRCm39) missense probably benign 0.00
IGL01933:Cgnl1 APN 9 71,552,765 (GRCm39) splice site probably benign
IGL01939:Cgnl1 APN 9 71,632,286 (GRCm39) missense probably damaging 1.00
IGL01947:Cgnl1 APN 9 71,632,326 (GRCm39) missense probably damaging 0.99
IGL02127:Cgnl1 APN 9 71,633,135 (GRCm39) missense probably damaging 1.00
IGL02379:Cgnl1 APN 9 71,552,835 (GRCm39) missense possibly damaging 0.82
IGL02510:Cgnl1 APN 9 71,632,639 (GRCm39) missense probably benign 0.41
FR4548:Cgnl1 UTSW 9 71,631,999 (GRCm39) small insertion probably benign
R0058:Cgnl1 UTSW 9 71,632,122 (GRCm39) missense probably damaging 0.99
R0058:Cgnl1 UTSW 9 71,548,679 (GRCm39) missense probably damaging 1.00
R0105:Cgnl1 UTSW 9 71,563,384 (GRCm39) missense probably benign
R0220:Cgnl1 UTSW 9 71,632,225 (GRCm39) missense possibly damaging 0.68
R0401:Cgnl1 UTSW 9 71,612,521 (GRCm39) missense probably damaging 1.00
R0541:Cgnl1 UTSW 9 71,558,535 (GRCm39) missense possibly damaging 0.54
R1018:Cgnl1 UTSW 9 71,633,340 (GRCm39) missense probably damaging 1.00
R1026:Cgnl1 UTSW 9 71,624,713 (GRCm39) missense possibly damaging 0.91
R1056:Cgnl1 UTSW 9 71,633,177 (GRCm39) missense probably damaging 1.00
R1299:Cgnl1 UTSW 9 71,628,994 (GRCm39) splice site probably benign
R1513:Cgnl1 UTSW 9 71,631,872 (GRCm39) missense probably benign 0.02
R1546:Cgnl1 UTSW 9 71,633,097 (GRCm39) missense probably benign
R1599:Cgnl1 UTSW 9 71,548,709 (GRCm39) missense probably benign 0.02
R1657:Cgnl1 UTSW 9 71,633,226 (GRCm39) missense probably damaging 0.98
R1970:Cgnl1 UTSW 9 71,632,817 (GRCm39) missense probably benign 0.10
R2004:Cgnl1 UTSW 9 71,537,821 (GRCm39) missense probably damaging 1.00
R2080:Cgnl1 UTSW 9 71,563,378 (GRCm39) missense probably benign 0.01
R2085:Cgnl1 UTSW 9 71,538,160 (GRCm39) missense probably damaging 1.00
R2357:Cgnl1 UTSW 9 71,632,950 (GRCm39) nonsense probably null
R2402:Cgnl1 UTSW 9 71,632,461 (GRCm39) missense probably damaging 1.00
R3954:Cgnl1 UTSW 9 71,631,945 (GRCm39) missense probably benign 0.01
R4043:Cgnl1 UTSW 9 71,612,575 (GRCm39) missense probably damaging 1.00
R4127:Cgnl1 UTSW 9 71,631,822 (GRCm39) missense probably benign 0.00
R4825:Cgnl1 UTSW 9 71,537,806 (GRCm39) missense probably benign 0.00
R4851:Cgnl1 UTSW 9 71,632,314 (GRCm39) missense probably damaging 1.00
R4882:Cgnl1 UTSW 9 71,624,683 (GRCm39) missense probably benign 0.00
R4996:Cgnl1 UTSW 9 71,632,108 (GRCm39) small deletion probably benign
R5057:Cgnl1 UTSW 9 71,632,076 (GRCm39) missense probably damaging 0.99
R5263:Cgnl1 UTSW 9 71,539,936 (GRCm39) nonsense probably null
R5402:Cgnl1 UTSW 9 71,536,603 (GRCm39) missense probably damaging 1.00
R5744:Cgnl1 UTSW 9 71,537,957 (GRCm39) splice site probably null
R5770:Cgnl1 UTSW 9 71,552,769 (GRCm39) splice site probably null
R6911:Cgnl1 UTSW 9 71,563,497 (GRCm39) missense possibly damaging 0.82
R7014:Cgnl1 UTSW 9 71,632,416 (GRCm39) missense possibly damaging 0.86
R7106:Cgnl1 UTSW 9 71,633,015 (GRCm39) missense probably benign 0.00
R7203:Cgnl1 UTSW 9 71,631,815 (GRCm39) missense possibly damaging 0.80
R7231:Cgnl1 UTSW 9 71,539,927 (GRCm39) missense probably benign 0.39
R7241:Cgnl1 UTSW 9 71,632,052 (GRCm39) missense probably benign
R7288:Cgnl1 UTSW 9 71,632,846 (GRCm39) missense possibly damaging 0.67
R7327:Cgnl1 UTSW 9 71,633,165 (GRCm39) missense possibly damaging 0.48
R7390:Cgnl1 UTSW 9 71,552,931 (GRCm39) missense probably benign 0.04
R7529:Cgnl1 UTSW 9 71,539,040 (GRCm39) missense probably damaging 1.00
R7793:Cgnl1 UTSW 9 71,632,917 (GRCm39) missense probably damaging 1.00
R7975:Cgnl1 UTSW 9 71,632,604 (GRCm39) missense probably benign 0.00
R7990:Cgnl1 UTSW 9 71,632,547 (GRCm39) missense probably damaging 1.00
R8502:Cgnl1 UTSW 9 71,537,887 (GRCm39) missense probably damaging 0.99
R8926:Cgnl1 UTSW 9 71,632,535 (GRCm39) missense probably benign
R9010:Cgnl1 UTSW 9 71,558,631 (GRCm39) missense probably damaging 1.00
R9106:Cgnl1 UTSW 9 71,628,873 (GRCm39) splice site probably benign
R9189:Cgnl1 UTSW 9 71,630,847 (GRCm39) nonsense probably null
R9395:Cgnl1 UTSW 9 71,539,954 (GRCm39) missense probably benign 0.01
R9680:Cgnl1 UTSW 9 71,562,632 (GRCm39) missense possibly damaging 0.65
R9694:Cgnl1 UTSW 9 71,632,803 (GRCm39) missense probably benign 0.32
R9760:Cgnl1 UTSW 9 71,552,853 (GRCm39) nonsense probably null
RF015:Cgnl1 UTSW 9 71,631,997 (GRCm39) small insertion probably benign
RF042:Cgnl1 UTSW 9 71,631,997 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGCCAGTGTTGAACTTTCCACACC -3'
(R):5'- AGCAGCAGCTTACTGTATTGTCACC -3'

Sequencing Primer
(F):5'- TAACCTGTGTTTAAAGCCCAGC -3'
(R):5'- GGACATGAACATCTGTGTCTTAG -3'
Posted On 2014-07-02