Incidental Mutation 'R0452:Smarcad1'
ID212452
Institutional Source Beutler Lab
Gene Symbol Smarcad1
Ensembl Gene ENSMUSG00000029920
Gene NameSWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1
SynonymsD6Pas1, Etl1
MMRRC Submission 038652-MU
Accession Numbers

Genbank: NM_007958; MGI: 95453

Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R0452 (G1)
Quality Score52
Status Validated
Chromosome6
Chromosomal Location65042583-65116061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65074822 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 313 (N313I)
Ref Sequence ENSEMBL: ENSMUSP00000031984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031984] [ENSMUST00000204620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031984
AA Change: N313I

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031984
Gene: ENSMUSG00000029920
AA Change: N313I

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
low complexity region 143 156 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 333 348 N/A INTRINSIC
DEXDc 488 682 2.58e-38 SMART
Blast:DEXDc 685 745 4e-16 BLAST
HELICc 879 962 4.58e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203756
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204420
Predicted Effect probably benign
Transcript: ENSMUST00000204620
SMART Domains Protein: ENSMUSP00000144767
Gene: ENSMUSG00000029920

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Meta Mutation Damage Score 0.0749 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SNF subfamily of helicase proteins. The encoded protein plays a critical role in the restoration of heterochromatin organization and propagation of epigenetic patterns following DNA replication by mediating histone H3/H4 deacetylation. Mutations in this gene are associated with adermatoglyphia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit retarded growth, impaired fertility, skeletal dysplasias, and peri- and postnatal lethality. Mutant phenotypes are influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(258) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(256)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030452D12Rik A G 8: 106,507,190 probably benign Het
Acap3 C A 4: 155,902,328 S347* probably null Het
Acvr1 G A 2: 58,500,495 P19L probably benign Het
Add2 G T 6: 86,104,629 E366* probably null Het
Ankrd28 C A 14: 31,748,738 A153S probably damaging Het
Anxa8 A T 14: 34,094,770 I206F probably damaging Het
Arhgef4 G A 1: 34,732,322 E1237K probably damaging Het
Arid1a C T 4: 133,689,105 A1120T unknown Het
Atad5 T C 11: 80,106,421 V857A probably damaging Het
Atp2a3 T A 11: 72,977,232 probably null Het
Atxn1l C T 8: 109,732,395 V412I possibly damaging Het
Card11 A G 5: 140,880,370 S923P probably benign Het
Cars C A 7: 143,592,625 E21* probably null Het
Ccdc115 A G 1: 34,437,621 probably benign Het
Ccnj T A 19: 40,845,064 probably null Het
Cds2 C T 2: 132,298,479 T182I probably damaging Het
Ceacam14 A G 7: 17,815,323 H213R probably benign Het
Cfap44 A T 16: 44,431,945 M806L probably benign Het
Chd8 A T 14: 52,214,587 I1317K probably damaging Het
Cherp A T 8: 72,461,522 probably benign Het
Creb5 C G 6: 53,604,542 T30S possibly damaging Het
Csf2ra A G 19: 61,226,895 M94T probably benign Het
Cyp2b19 A C 7: 26,766,762 D330A probably benign Het
Ddost G A 4: 138,310,188 V188M possibly damaging Het
Dnah7a A T 1: 53,605,819 D1019E probably benign Het
Dtx1 A T 5: 120,694,992 I127N possibly damaging Het
Dyrk2 T C 10: 118,868,763 T3A possibly damaging Het
Elovl5 C T 9: 77,960,911 T35M probably damaging Het
Emc7 T C 2: 112,466,969 probably benign Het
Erp27 T C 6: 136,909,489 Y182C probably damaging Het
Exoc2 T A 13: 30,886,327 probably benign Het
F5 A C 1: 164,185,107 D530A probably damaging Het
Fam149a A T 8: 45,355,649 V149E probably damaging Het
Fbxo41 A G 6: 85,478,182 S614P probably damaging Het
Fmn1 T A 2: 113,636,779 Y1342N possibly damaging Het
Gm10334 A G 6: 41,445,337 Y45H probably benign Het
Gpr22 T A 12: 31,708,794 D443V possibly damaging Het
Il17rd T A 14: 27,091,931 W56R probably damaging Het
Itga2b A T 11: 102,465,953 probably null Het
Jmjd1c T C 10: 67,255,482 M2514T probably benign Het
Klk9 T C 7: 43,794,251 probably benign Het
Krr1 T C 10: 111,975,598 Y66H probably damaging Het
Lamb2 T C 9: 108,486,354 probably benign Het
Lgals3bp A T 11: 118,393,464 Y430N probably benign Het
Lrp10 T C 14: 54,467,579 V113A probably benign Het
Mgam A G 6: 40,759,090 Y841C probably damaging Het
Nisch T A 14: 31,177,464 probably benign Het
Nlrp4d G A 7: 10,378,292 T650I probably benign Het
Olfr1314 T A 2: 112,092,636 K22* probably null Het
Olfr506 C T 7: 108,612,370 T21I possibly damaging Het
Parp4 A G 14: 56,648,843 D1793G unknown Het
Pcm1 A G 8: 41,325,905 D1850G probably benign Het
Pgap2 G A 7: 102,236,462 A145T probably damaging Het
Phc1 G A 6: 122,323,036 A583V probably damaging Het
Plcd3 G A 11: 103,071,259 probably benign Het
Ppm1m T A 9: 106,197,302 Q214L probably damaging Het
Prkg2 A G 5: 98,997,520 probably benign Het
Rasal3 T C 17: 32,395,817 probably benign Het
Rfc1 A T 5: 65,264,297 D1086E probably benign Het
Rnf145 T A 11: 44,561,760 L522H probably damaging Het
Setd2 T A 9: 110,553,100 probably null Het
Sik1 C A 17: 31,849,081 V377F possibly damaging Het
Slc44a4 T C 17: 34,928,095 I367T possibly damaging Het
Slfn3 A G 11: 83,213,128 D275G possibly damaging Het
Smc4 A T 3: 69,008,028 K138* probably null Het
Smg6 T A 11: 74,930,213 S437T probably benign Het
Spaca9 G T 2: 28,695,993 Q20K probably damaging Het
Spatc1 T G 15: 76,268,293 I41S probably damaging Het
Spink5 A T 18: 43,963,318 T5S possibly damaging Het
St3gal1 C A 15: 67,109,655 probably benign Het
Stat5a C A 11: 100,863,135 T97K probably benign Het
Stat5b A T 11: 100,798,330 I246N probably benign Het
Supt6 G T 11: 78,227,003 D462E probably damaging Het
Swi5 A T 2: 32,281,824 probably benign Het
Syne1 A T 10: 5,405,435 V375E probably damaging Het
Tcp1 T C 17: 12,924,352 F516S probably benign Het
Tdrd7 A T 4: 45,965,488 probably benign Het
Tgfbr3 A T 5: 107,140,423 N457K probably benign Het
Tmem209 A G 6: 30,487,381 M500T probably damaging Het
Tmem44 C T 16: 30,517,463 probably benign Het
Ttc21a T A 9: 119,939,154 probably benign Het
Ttn T A 2: 76,836,003 I88F possibly damaging Het
Ttn A G 2: 76,871,110 probably benign Het
Ube2w T C 1: 16,602,255 probably benign Het
Ufc1 C T 1: 171,289,954 probably benign Het
Uhmk1 A G 1: 170,212,402 M132T possibly damaging Het
Usp29 A G 7: 6,963,182 N675D possibly damaging Het
Vmn1r23 A G 6: 57,926,484 V103A possibly damaging Het
Wdr59 G T 8: 111,521,972 R4S possibly damaging Het
Zc3hav1 T A 6: 38,307,437 E914D probably benign Het
Other mutations in Smarcad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02318:Smarcad1 APN 6 65073239 missense probably damaging 1.00
IGL02707:Smarcad1 APN 6 65052806 unclassified probably benign
IGL03006:Smarcad1 APN 6 65083889 missense probably benign 0.01
IGL03131:Smarcad1 APN 6 65074953 missense probably damaging 0.96
IGL03406:Smarcad1 APN 6 65092526 missense probably damaging 0.98
Trollip UTSW 6 65114336 missense probably damaging 1.00
wastrel UTSW 6 65052670 missense probably damaging 1.00
N/A - 293:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R0020:Smarcad1 UTSW 6 65084007 splice site probably benign
R1005:Smarcad1 UTSW 6 65108727 missense probably benign 0.30
R1143:Smarcad1 UTSW 6 65096694 missense probably benign 0.02
R1624:Smarcad1 UTSW 6 65052647 missense probably benign 0.40
R1629:Smarcad1 UTSW 6 65067107 missense probably benign 0.00
R1705:Smarcad1 UTSW 6 65056416 missense probably damaging 1.00
R2000:Smarcad1 UTSW 6 65073216 missense probably damaging 1.00
R2979:Smarcad1 UTSW 6 65075011 missense probably benign 0.00
R3937:Smarcad1 UTSW 6 65114336 missense probably damaging 1.00
R4391:Smarcad1 UTSW 6 65056459 missense probably benign 0.17
R4648:Smarcad1 UTSW 6 65067089 missense probably benign 0.04
R4697:Smarcad1 UTSW 6 65052641 missense probably benign 0.00
R4709:Smarcad1 UTSW 6 65075115 missense probably benign 0.01
R4726:Smarcad1 UTSW 6 65075041 missense probably damaging 1.00
R4776:Smarcad1 UTSW 6 65098824 missense probably null 1.00
R4928:Smarcad1 UTSW 6 65074914 missense probably benign 0.06
R5619:Smarcad1 UTSW 6 65111881 missense probably benign 0.03
R5709:Smarcad1 UTSW 6 65074762 missense probably benign 0.01
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6038:Smarcad1 UTSW 6 65073248 missense possibly damaging 0.91
R6220:Smarcad1 UTSW 6 65114329 missense probably benign 0.09
R6302:Smarcad1 UTSW 6 65075138 missense possibly damaging 0.93
R7014:Smarcad1 UTSW 6 65052670 missense probably damaging 1.00
R7149:Smarcad1 UTSW 6 65052732 missense probably benign 0.11
R7378:Smarcad1 UTSW 6 65110376 missense probably benign 0.16
R7569:Smarcad1 UTSW 6 65052711 missense probably benign 0.11
R7626:Smarcad1 UTSW 6 65096049 missense possibly damaging 0.71
R7774:Smarcad1 UTSW 6 65107830 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTCAGGAGGCTTGCTTAGGAG -3'
(R):5'- ACAGGAGAAGGCCACCCATCTATG -3'

Sequencing Primer
(F):5'- AGGTGCCATGTACTTTTGAAATGTC -3'
(R):5'- acacacagacacagacacac -3'
Posted On2014-07-02