Incidental Mutation 'R0007:Sparcl1'
ID212462
Institutional Source Beutler Lab
Gene Symbol Sparcl1
Ensembl Gene ENSMUSG00000029309
Gene NameSPARC-like 1
SynonymsEcm2, mast9, Sc1, hevin
MMRRC Submission 038302-MU
Accession Numbers

Ncbi RefSeq: NM_010097.4; MGI:108110

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0007 (G1)
Quality Score20
Status Validated
Chromosome5
Chromosomal Location104079111-104113733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104087080 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 523 (Q523L)
Ref Sequence ENSEMBL: ENSMUSP00000031249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031249]
Predicted Effect probably damaging
Transcript: ENSMUST00000031249
AA Change: Q523L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031249
Gene: ENSMUSG00000029309
AA Change: Q523L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
low complexity region 330 340 N/A INTRINSIC
low complexity region 372 381 N/A INTRINSIC
FOLN 418 441 2.33e-5 SMART
KAZAL 441 495 3.62e-11 SMART
Pfam:SPARC_Ca_bdg 498 636 2.8e-44 PFAM
Meta Mutation Damage Score 0.6706 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.5%
Validation Efficiency 100% (38/38)
MGI Phenotype Strain: 2153047
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(1) Gene trapped(4)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A T 17: 35,959,670 Y543N probably damaging Het
Adgrb3 C A 1: 25,111,691 probably null Het
AI504432 T A 3: 107,048,836 noncoding transcript Het
Cd82 T C 2: 93,433,881 N39S probably benign Het
Cntnap2 A C 6: 45,992,073 N250H possibly damaging Het
Col7a1 T C 9: 108,961,403 V973A unknown Het
Cyp2c66 T A 19: 39,170,958 C284* probably null Het
Denr T A 5: 123,924,814 Y127N probably damaging Het
Diaph3 C A 14: 86,866,620 R776L possibly damaging Het
Gm5600 T A 7: 113,707,773 noncoding transcript Het
Hephl1 A T 9: 15,086,175 D398E possibly damaging Het
Lama3 T A 18: 12,497,881 probably benign Het
Mtrr A T 13: 68,575,330 F154L probably benign Het
Myo1b T A 1: 51,776,254 R650S probably damaging Het
Nek10 T A 14: 14,840,574 H153Q probably benign Het
Nelfe A G 17: 34,853,986 probably benign Het
Nlrp9a T C 7: 26,551,090 probably benign Het
Nos1 T C 5: 117,910,088 S653P probably damaging Het
Olfr502 A G 7: 108,523,213 S246P probably damaging Het
Olfr888 A T 9: 38,109,094 Y131F possibly damaging Het
Pcsk5 C A 19: 17,654,861 G314C probably damaging Het
Ralgps1 A G 2: 33,143,389 S393P probably damaging Het
Slc44a4 G A 17: 34,921,254 A60T probably damaging Het
Slc4a4 G A 5: 89,038,578 D173N probably damaging Het
Srgap3 A G 6: 112,829,512 Y63H probably damaging Het
Trim16 A G 11: 62,829,118 M84V probably benign Het
Trpm3 G A 19: 22,987,529 A1453T probably benign Het
Ttn C T 2: 76,880,204 probably benign Het
Other mutations in Sparcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Sparcl1 APN 5 104092922 missense probably benign 0.04
IGL01291:Sparcl1 APN 5 104094715 missense possibly damaging 0.88
IGL01958:Sparcl1 APN 5 104092540 missense probably benign 0.30
IGL02749:Sparcl1 APN 5 104092880 missense possibly damaging 0.57
IGL03034:Sparcl1 APN 5 104093237 missense probably damaging 0.96
ANU05:Sparcl1 UTSW 5 104094715 missense possibly damaging 0.88
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0278:Sparcl1 UTSW 5 104088397 missense probably benign 0.16
R0360:Sparcl1 UTSW 5 104089637 missense probably damaging 0.99
R0581:Sparcl1 UTSW 5 104093312 missense probably damaging 0.99
R1755:Sparcl1 UTSW 5 104092824 missense probably benign 0.12
R1807:Sparcl1 UTSW 5 104085761 missense probably damaging 1.00
R1925:Sparcl1 UTSW 5 104093354 missense probably benign 0.09
R2110:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2112:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2331:Sparcl1 UTSW 5 104085794 missense probably damaging 1.00
R2567:Sparcl1 UTSW 5 104085088 missense probably damaging 1.00
R3029:Sparcl1 UTSW 5 104093226 missense possibly damaging 0.59
R3104:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3106:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3979:Sparcl1 UTSW 5 104092781 missense probably benign 0.00
R4772:Sparcl1 UTSW 5 104088490 missense probably benign 0.15
R4967:Sparcl1 UTSW 5 104092910 missense probably damaging 1.00
R5095:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5103:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5105:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5140:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5149:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R6245:Sparcl1 UTSW 5 104085147 missense probably damaging 1.00
R6387:Sparcl1 UTSW 5 104085060 missense probably damaging 1.00
R6544:Sparcl1 UTSW 5 104092444 nonsense probably null
R6930:Sparcl1 UTSW 5 104087074 missense probably damaging 1.00
R7246:Sparcl1 UTSW 5 104085157 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTTTCTCTGCCAAGCAGTG -3'
(R):5'- TGGGGCTCAACAACAACCAGAGTG -3'

Sequencing Primer
(F):5'- TGCCAAGCAGTGCTCCTAC -3'
(R):5'- tgtttgtttgtttgtttgtttgtttg -3'
Posted On2014-07-03