Mutagenetix > Incidental Mutation

Incidental Mutation 'R0124:Arid1b'

21248

Institutional Source

Beutler Lab

Gene Symbol

Arid1b

Ensembl Gene

ENSMUSG00000069729

Gene Name

AT rich interactive domain 1B (SWI-like)

Synonyms

B230217J03Rik, 9330189K18Rik

MMRRC Submission

038409-MU

Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Essential gene?

Possibly essential (E-score: 0.750) question?

Stock #

R0124 (G1)

Quality Score

195

Status

Validated (trace)

Chromosome

Chromosomal Location

4994332-5347656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 5339330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 1717 (T1717I)

Ref Sequence

ENSEMBL: ENSMUSP00000156119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]

AlphaFold

E9Q4N7

Predicted Effect

probably damaging
Transcript: ENSMUST00000092723
AA Change: T1664I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: T1664I

Domain	Start	End	E-Value	Type
low complexity region	2	51	N/A	INTRINSIC
low complexity region	69	132	N/A	INTRINSIC
low complexity region	139	150	N/A	INTRINSIC
low complexity region	201	224	N/A	INTRINSIC
low complexity region	232	247	N/A	INTRINSIC
low complexity region	257	276	N/A	INTRINSIC
low complexity region	301	371	N/A	INTRINSIC
low complexity region	379	407	N/A	INTRINSIC
low complexity region	438	476	N/A	INTRINSIC
low complexity region	485	499	N/A	INTRINSIC
low complexity region	538	558	N/A	INTRINSIC
low complexity region	574	591	N/A	INTRINSIC
low complexity region	596	611	N/A	INTRINSIC
low complexity region	615	640	N/A	INTRINSIC
low complexity region	691	707	N/A	INTRINSIC
low complexity region	719	740	N/A	INTRINSIC
low complexity region	743	773	N/A	INTRINSIC
low complexity region	805	816	N/A	INTRINSIC
low complexity region	912	930	N/A	INTRINSIC
low complexity region	936	952	N/A	INTRINSIC
low complexity region	974	985	N/A	INTRINSIC
low complexity region	1036	1045	N/A	INTRINSIC
ARID	1057	1147	9.9e-33	SMART
BRIGHT	1061	1152	7.62e-41	SMART
low complexity region	1166	1177	N/A	INTRINSIC
low complexity region	1257	1268	N/A	INTRINSIC
low complexity region	1336	1364	N/A	INTRINSIC
low complexity region	1426	1456	N/A	INTRINSIC
low complexity region	1473	1486	N/A	INTRINSIC
low complexity region	1579	1595	N/A	INTRINSIC
coiled coil region	1724	1745	N/A	INTRINSIC
low complexity region	1835	1843	N/A	INTRINSIC
Pfam:DUF3518	1933	2189	1.5e-152	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115797
AA Change: T1665I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: T1665I

Domain	Start	End	E-Value	Type
low complexity region	17	80	N/A	INTRINSIC
low complexity region	87	98	N/A	INTRINSIC
low complexity region	149	172	N/A	INTRINSIC
low complexity region	180	195	N/A	INTRINSIC
low complexity region	205	224	N/A	INTRINSIC
low complexity region	249	319	N/A	INTRINSIC
low complexity region	327	355	N/A	INTRINSIC
low complexity region	386	424	N/A	INTRINSIC
low complexity region	433	447	N/A	INTRINSIC
low complexity region	486	506	N/A	INTRINSIC
low complexity region	522	539	N/A	INTRINSIC
low complexity region	544	559	N/A	INTRINSIC
low complexity region	563	588	N/A	INTRINSIC
low complexity region	639	655	N/A	INTRINSIC
low complexity region	667	688	N/A	INTRINSIC
low complexity region	691	721	N/A	INTRINSIC
low complexity region	753	764	N/A	INTRINSIC
low complexity region	860	878	N/A	INTRINSIC
low complexity region	884	900	N/A	INTRINSIC
low complexity region	922	933	N/A	INTRINSIC
Blast:ARID	981	1028	1e-8	BLAST
low complexity region	1029	1054	N/A	INTRINSIC
ARID	1058	1148	9.9e-33	SMART
BRIGHT	1062	1153	7.62e-41	SMART
low complexity region	1167	1178	N/A	INTRINSIC
low complexity region	1258	1269	N/A	INTRINSIC
low complexity region	1337	1365	N/A	INTRINSIC
low complexity region	1427	1457	N/A	INTRINSIC
low complexity region	1474	1487	N/A	INTRINSIC
low complexity region	1580	1596	N/A	INTRINSIC
coiled coil region	1725	1746	N/A	INTRINSIC
low complexity region	1836	1844	N/A	INTRINSIC
Pfam:DUF3518	1935	2190	6.3e-121	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115799
AA Change: T1183I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: T1183I

Domain	Start	End	E-Value	Type
low complexity region	34	54	N/A	INTRINSIC
low complexity region	70	87	N/A	INTRINSIC
low complexity region	92	107	N/A	INTRINSIC
low complexity region	111	136	N/A	INTRINSIC
low complexity region	187	203	N/A	INTRINSIC
low complexity region	215	236	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	378	396	N/A	INTRINSIC
low complexity region	402	418	N/A	INTRINSIC
low complexity region	440	451	N/A	INTRINSIC
Blast:ARID	499	546	1e-8	BLAST
low complexity region	547	572	N/A	INTRINSIC
ARID	576	666	9.9e-33	SMART
BRIGHT	580	671	7.62e-41	SMART
low complexity region	685	696	N/A	INTRINSIC
low complexity region	776	787	N/A	INTRINSIC
low complexity region	855	883	N/A	INTRINSIC
low complexity region	945	975	N/A	INTRINSIC
low complexity region	992	1005	N/A	INTRINSIC
low complexity region	1098	1114	N/A	INTRINSIC
coiled coil region	1243	1264	N/A	INTRINSIC
low complexity region	1354	1362	N/A	INTRINSIC
Pfam:DUF3518	1452	1708	1.1e-152	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000232180
AA Change: T1717I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.0828

Coding Region Coverage

1x: 99.3%
3x: 98.3%
10x: 95.7%
20x: 89.8%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]

Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003E16Rik	A	G	6: 83,161,674	T194A	probably benign	Het
Afap1	C	T	5: 35,945,209	P82S	probably damaging	Het
Ankrd28	A	G	14: 31,727,741	Y481H	probably damaging	Het
Atad2b	A	G	12: 4,952,676	K348R	probably benign	Het
B020004J07Rik	A	G	4: 101,835,373	*477Q	probably null	Het
Bcl3	C	T	7: 19,809,651	V5M	probably damaging	Het
C2cd3	A	G	7: 100,469,518	E2321G	probably benign	Het
Casq1	C	T	1: 172,210,425	V380M	probably damaging	Het
Cd209e	T	A	8: 3,851,274	T127S	probably benign	Het
Cdh23	G	T	10: 60,308,056	Y2921*	probably null	Het
Cdh6	A	G	15: 13,034,324	L750P	probably damaging	Het
Cdk12	T	C	11: 98,211,247		probably benign	Het
Ces5a	T	C	8: 93,528,555	E170G	probably damaging	Het
Clec4f	A	G	6: 83,652,353		probably null	Het
Col19a1	T	C	1: 24,526,458	N264S	unknown	Het
Col2a1	T	A	15: 97,998,862	I43F	unknown	Het
Col4a2	A	G	8: 11,408,871		probably benign	Het
Csmd3	T	A	15: 47,590,716	D3578V	probably damaging	Het
Cyp2c37	T	C	19: 39,994,102	L128P	probably damaging	Het
Dysf	A	G	6: 84,065,102		probably benign	Het
Eml1	A	G	12: 108,509,178	Y256C	probably damaging	Het
Eml1	T	C	12: 108,506,608	V225A	probably benign	Het
Epb41l5	T	A	1: 119,633,640	K64*	probably null	Het
Fat2	A	G	11: 55,283,678	F2070L	probably damaging	Het
Fbxw18	G	T	9: 109,691,515	H259N	probably benign	Het
Gm10764	A	T	10: 87,290,748	T6S	unknown	Het
Gm14412	A	G	2: 177,315,912		probably benign	Het
Heatr5b	A	T	17: 78,826,217		probably benign	Het
Hid1	T	C	11: 115,356,823	T250A	probably damaging	Het
Hnf4g	A	G	3: 3,643,082		probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Lrriq1	C	T	10: 103,170,420		probably null	Het
Map3k13	A	G	16: 21,903,756	T223A	possibly damaging	Het
Matn2	C	T	15: 34,426,151		probably benign	Het
Myo6	A	G	9: 80,307,774	E1253G	probably damaging	Het
Nomo1	G	T	7: 46,083,228		probably benign	Het
Olfr1221	A	T	2: 89,111,744	I256K	possibly damaging	Het
Olfr160	A	G	9: 37,711,463	V272A	possibly damaging	Het
Olfr356	A	T	2: 36,937,256	I46F	possibly damaging	Het
Papolg	C	T	11: 23,867,535	A582T	probably benign	Het
Plekhm3	C	T	1: 64,921,751	E449K	probably damaging	Het
Pole	T	G	5: 110,303,992	M900R	probably damaging	Het
Ppp1cb	T	A	5: 32,483,478		probably benign	Het
Pros1	A	G	16: 62,913,946	T372A	possibly damaging	Het
Scara3	A	T	14: 65,931,221	S316T	probably benign	Het
St5	A	G	7: 109,542,511	S132P	possibly damaging	Het
Stau2	C	T	1: 16,463,128	A61T	probably damaging	Het
Stx3	T	C	19: 11,791,799	E54G	possibly damaging	Het
Sun1	T	C	5: 139,246,679		probably benign	Het
Swt1	A	T	1: 151,391,529	C634S	probably damaging	Het
Syt6	A	G	3: 103,587,526	Y269C	probably damaging	Het
Tfap2a	G	A	13: 40,717,411		probably benign	Het
Tmx4	A	T	2: 134,639,720		probably null	Het
Ttc39d	T	C	17: 80,216,946	C345R	probably damaging	Het
Vmn1r27	T	C	6: 58,215,248	Y257C	probably damaging	Het
Vmn2r27	T	A	6: 124,231,619	T56S	probably benign	Het
Vps13b	T	C	15: 35,576,528		probably null	Het
Wdr17	A	G	8: 54,635,491	S1175P	probably damaging	Het
Wsb2	T	C	5: 117,363,758	F63L	probably benign	Het
Zfp142	A	G	1: 74,568,623	Y1561H	probably damaging	Het

Other mutations in Arid1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00325:Arid1b	APN	17	5337110	missense	possibly damaging	0.77
IGL00340:Arid1b	APN	17	5321284	missense	probably damaging	1.00
IGL00886:Arid1b	APN	17	5126979	missense	probably damaging	0.99
IGL01161:Arid1b	APN	17	5342399	missense	probably damaging	1.00
IGL01391:Arid1b	APN	17	5318858	splice site	probably benign
IGL01456:Arid1b	APN	17	5291235	missense	probably damaging	1.00
IGL02152:Arid1b	APN	17	5313968	missense	probably damaging	1.00
IGL02288:Arid1b	APN	17	5264040	missense	possibly damaging	0.88
IGL02713:Arid1b	APN	17	5343011	missense	probably damaging	1.00
IGL02858:Arid1b	APN	17	5341891	missense	possibly damaging	0.92
IGL02885:Arid1b	APN	17	5342153	missense	probably damaging	1.00
IGL02989:Arid1b	APN	17	5335047	missense	probably damaging	1.00
FR4449:Arid1b	UTSW	17	4995589	small insertion	probably benign
PIT4142001:Arid1b	UTSW	17	5339243	missense	probably damaging	1.00
R0048:Arid1b	UTSW	17	5314034	critical splice donor site	probably null
R0153:Arid1b	UTSW	17	5342932	missense	probably damaging	1.00
R0465:Arid1b	UTSW	17	4996260	missense	possibly damaging	0.68
R0825:Arid1b	UTSW	17	5342178	missense	probably damaging	1.00
R1172:Arid1b	UTSW	17	5339300	missense	probably damaging	1.00
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1468:Arid1b	UTSW	17	5242922	missense	probably damaging	0.99
R1616:Arid1b	UTSW	17	5339294	missense	probably damaging	1.00
R1754:Arid1b	UTSW	17	5279201	critical splice acceptor site	probably null
R1760:Arid1b	UTSW	17	5341813	missense	probably damaging	0.97
R1812:Arid1b	UTSW	17	5337029	missense	probably benign	0.10
R1911:Arid1b	UTSW	17	5342966	missense	probably damaging	1.00
R3874:Arid1b	UTSW	17	5336515	splice site	probably null
R3913:Arid1b	UTSW	17	5342257	missense	possibly damaging	0.94
R3916:Arid1b	UTSW	17	5342653	missense	probably benign	0.25
R3922:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R4119:Arid1b	UTSW	17	4995794	unclassified	probably benign
R4290:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4291:Arid1b	UTSW	17	5040663	missense	probably damaging	1.00
R4352:Arid1b	UTSW	17	5097584	missense	possibly damaging	0.93
R4386:Arid1b	UTSW	17	4994972	unclassified	probably benign
R4458:Arid1b	UTSW	17	5242916	missense	probably damaging	0.99
R4524:Arid1b	UTSW	17	5097620	missense	possibly damaging	0.93
R4622:Arid1b	UTSW	17	4995050	unclassified	probably benign
R4723:Arid1b	UTSW	17	5337290	missense	probably benign	0.01
R4782:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4799:Arid1b	UTSW	17	5339221	missense	probably damaging	1.00
R4910:Arid1b	UTSW	17	5342203	missense	probably damaging	1.00
R4946:Arid1b	UTSW	17	5342843	missense	probably damaging	0.99
R5083:Arid1b	UTSW	17	5314018	missense	possibly damaging	0.54
R5204:Arid1b	UTSW	17	5343041	missense	probably damaging	0.97
R5347:Arid1b	UTSW	17	5291057	nonsense	probably null
R5553:Arid1b	UTSW	17	5313877	missense	probably damaging	1.00
R5713:Arid1b	UTSW	17	5336816	missense	probably damaging	1.00
R5820:Arid1b	UTSW	17	4996254	missense	possibly damaging	0.96
R5992:Arid1b	UTSW	17	4994956	unclassified	probably benign
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6038:Arid1b	UTSW	17	5336682	missense	probably benign	0.07
R6153:Arid1b	UTSW	17	5242832	missense	probably damaging	1.00
R6222:Arid1b	UTSW	17	5327647	critical splice acceptor site	probably null
R6249:Arid1b	UTSW	17	5279361	missense	possibly damaging	0.61
R6279:Arid1b	UTSW	17	5341999	missense	probably damaging	1.00
R6329:Arid1b	UTSW	17	5337263	nonsense	probably null
R6368:Arid1b	UTSW	17	5332533	missense	possibly damaging	0.64
R6466:Arid1b	UTSW	17	5327678	missense	probably damaging	1.00
R6861:Arid1b	UTSW	17	5327686	missense	possibly damaging	0.93
R7008:Arid1b	UTSW	17	5290979	missense	probably damaging	1.00
R7270:Arid1b	UTSW	17	4996043	missense	unknown
R7514:Arid1b	UTSW	17	5341714	missense	probably benign	0.28
R7519:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7519:Arid1b	UTSW	17	4995853	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995844	small insertion	probably benign
R7521:Arid1b	UTSW	17	4995860	small insertion	probably benign
R7521:Arid1b	UTSW	17	5342590	missense	probably benign	0.06
R7616:Arid1b	UTSW	17	4995386	missense	unknown
R7654:Arid1b	UTSW	17	5291085	missense	possibly damaging	0.46
R7711:Arid1b	UTSW	17	5336820	missense	probably benign	0.28
R7828:Arid1b	UTSW	17	5097668	missense	probably damaging	1.00
R7864:Arid1b	UTSW	17	5342255	missense	probably damaging	1.00
R7998:Arid1b	UTSW	17	5327684	missense	probably damaging	1.00
R8105:Arid1b	UTSW	17	5291243	missense	possibly damaging	0.81
R8260:Arid1b	UTSW	17	5332513	missense	probably benign	0.03
R8374:Arid1b	UTSW	17	5342644	missense	possibly damaging	0.95
R8779:Arid1b	UTSW	17	5341534	missense	probably benign	0.03
R8801:Arid1b	UTSW	17	5336828	missense	probably benign	0.05
R8894:Arid1b	UTSW	17	5327393	missense	probably damaging	0.98
R8982:Arid1b	UTSW	17	5243041	missense	probably damaging	0.98
R9034:Arid1b	UTSW	17	5336905	missense	probably benign	0.01
R9272:Arid1b	UTSW	17	5336604	missense	possibly damaging	0.80
R9300:Arid1b	UTSW	17	5242999	missense	probably damaging	1.00
R9332:Arid1b	UTSW	17	4995309	missense	unknown
R9481:Arid1b	UTSW	17	5318732	missense	probably damaging	1.00
R9493:Arid1b	UTSW	17	4996148	missense	unknown
R9512:Arid1b	UTSW	17	5341589	missense	probably benign	0.00
R9548:Arid1b	UTSW	17	5334987	missense	probably damaging	1.00
RF007:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995594	small insertion	probably benign
RF008:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF025:Arid1b	UTSW	17	4995596	small insertion	probably benign
RF028:Arid1b	UTSW	17	4995598	small insertion	probably benign
RF032:Arid1b	UTSW	17	4995588	small insertion	probably benign
RF033:Arid1b	UTSW	17	4995585	small insertion	probably benign
RF041:Arid1b	UTSW	17	4995595	small insertion	probably benign
RF045:Arid1b	UTSW	17	4995583	small insertion	probably benign
RF046:Arid1b	UTSW	17	4995590	small insertion	probably benign
RF058:Arid1b	UTSW	17	4995583	small insertion	probably benign
X0023:Arid1b	UTSW	17	5342393	missense	probably benign	0.39
X0027:Arid1b	UTSW	17	5342372	nonsense	probably null
Z1177:Arid1b	UTSW	17	4996328	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TCCAGAGCCGAGGTTCATAATACCC -3'
(R):5'- GGTTGAAGGCTGCACTACATGAGAC -3'

Sequencing Primer
(F):5'- GAGGTTCATAATACCCGTTCTCC -3'
(R):5'- cacacacacacacacacacac -3'

Posted On

2013-04-11